ID: 1157568178

View in Genome Browser
Species Human (GRCh38)
Location 18:48694219-48694241
Sequence ACATCTACTAGGTTTTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157568178_1157568183 25 Left 1157568178 18:48694219-48694241 CCATATCAAAACCTAGTAGATGT 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1157568183 18:48694267-48694289 ATGGACGCTATTCCTGCCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1157568178_1157568180 -4 Left 1157568178 18:48694219-48694241 CCATATCAAAACCTAGTAGATGT 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1157568180 18:48694238-48694260 ATGTAAGAAGTTAGACACTCTGG 0: 1
1: 0
2: 0
3: 8
4: 173
1157568178_1157568182 6 Left 1157568178 18:48694219-48694241 CCATATCAAAACCTAGTAGATGT 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1157568182 18:48694248-48694270 TTAGACACTCTGGCTAGGAATGG 0: 1
1: 0
2: 0
3: 9
4: 144
1157568178_1157568181 1 Left 1157568178 18:48694219-48694241 CCATATCAAAACCTAGTAGATGT 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1157568181 18:48694243-48694265 AGAAGTTAGACACTCTGGCTAGG 0: 1
1: 0
2: 3
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157568178 Original CRISPR ACATCTACTAGGTTTTGATA TGG (reversed) Intronic
906064664 1:42971798-42971820 AAATCCACTAAGTTTTGAGATGG - Intergenic
909018679 1:70407479-70407501 ATATCAATTATGTTTTGATATGG - Intergenic
909251760 1:73366546-73366568 ACATCTACTGGATTTTACTATGG + Intergenic
910276226 1:85451842-85451864 AAATGTACTAGGCTTTCATATGG + Intronic
916607455 1:166357493-166357515 TCATTTAATAGGTTTTGAAAGGG - Intergenic
918901723 1:190429904-190429926 ACATCTACCTGGTTTTTAAAGGG + Intronic
919219319 1:194606146-194606168 ACATATACAATGTTTTGAAATGG - Intergenic
920576694 1:207066221-207066243 ACATAGACTTGGTTTTGTTATGG - Intronic
921589658 1:216988579-216988601 AGATTTACTGGGTTCTGATATGG + Intronic
922091468 1:222399475-222399497 ACATCTCCAAGGTTTAGGTATGG + Intergenic
1064843384 10:19622562-19622584 AGACCTACAAGGTTTTCATAGGG + Intronic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1065388132 10:25154066-25154088 ACATCTGCTGGGTTTTTAGATGG + Intergenic
1067264041 10:44721542-44721564 ACATCTTCTATTTTTGGATAAGG + Intergenic
1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG + Intergenic
1068590738 10:58850438-58850460 ACATTTACTAGATTCTCATAAGG - Intergenic
1069361283 10:67644636-67644658 AAATGTACTGGTTTTTGATAAGG + Intronic
1073638480 10:105223674-105223696 ACAACTAGTAAGTATTGATAAGG - Intronic
1074607991 10:114993518-114993540 ACTGCTACTAAGTTTTGATCAGG - Intergenic
1080357181 11:31463077-31463099 ACTTCAACTAGGTTTTCAAAAGG + Intronic
1081012786 11:37836443-37836465 TAATCCACTAGGTTCTGATACGG + Intergenic
1081910871 11:46699136-46699158 ACATCTCCTAAGTTTTCTTAGGG - Intronic
1088936720 11:114409314-114409336 AAACCTACTAAGTTTTCATATGG - Intronic
1089872028 11:121683711-121683733 ACAACTACTTTGTTTTGATAGGG - Intergenic
1092690744 12:11107499-11107521 ACATCTGCTGGGATTTGATAGGG - Intronic
1097677806 12:62621848-62621870 ACAGCTACTAAGTTTTGGGATGG + Intergenic
1097811602 12:64024978-64025000 ACATTTGCTAGGCATTGATATGG - Intronic
1104094104 12:125540842-125540864 AGCTCTACTAGGTCATGATAAGG - Intronic
1105405814 13:20131737-20131759 TGCTCTACTAGGTTCTGATAGGG - Intergenic
1106800976 13:33255486-33255508 ACATCTACTAGGCTGGGAGAGGG - Intronic
1108336687 13:49449635-49449657 ACATTTAGTCAGTTTTGATAAGG + Intronic
1109571356 13:64194274-64194296 ACATTTACTTGGTTTTCATATGG + Intergenic
1110099933 13:71586038-71586060 ACAGCCAGTAGGTTTAGATATGG - Intronic
1116609101 14:47044299-47044321 ACATCTACTAGACTTTGATTTGG + Intronic
1117964561 14:61193551-61193573 TCATATTCTAGGTTTTGATCAGG - Intronic
1121699704 14:95943373-95943395 ACATCTGCCAGGTTTTGCCATGG + Intergenic
1125207582 15:37171876-37171898 ACATCTCCTAGGTCTAGTTATGG + Intergenic
1127663268 15:61120149-61120171 ACATGTCCTATATTTTGATATGG + Intronic
1128124044 15:65177476-65177498 ACATCTAGTACCTTTTCATATGG + Intronic
1134127791 16:11628385-11628407 GCATCTACTGGGTGTTGATCTGG - Intronic
1140158853 16:72463246-72463268 ACATCACCTTGGTTGTGATATGG + Intergenic
1148860407 17:50601584-50601606 AAATCTACTTGGTTTTGACCTGG - Intronic
1151837481 17:76592432-76592454 ACATCTAATACATTTTGATTAGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1157568178 18:48694219-48694241 ACATCTACTAGGTTTTGATATGG - Intronic
1160050030 18:75424681-75424703 ACATCTACTACAATGTGATATGG - Intronic
929841991 2:45476393-45476415 ACATTTAATAGCTTTTGACAAGG + Intronic
932557519 2:72838287-72838309 CCACCTAGTAAGTTTTGATAAGG + Intergenic
933324909 2:80823262-80823284 TCATCTCCCAGGTTCTGATAAGG - Intergenic
937813970 2:126230926-126230948 ACATCTAAAAGATTTTCATAAGG - Intergenic
938827079 2:135016545-135016567 AAACCTGCTAGGTTTTGATTGGG + Intronic
939139841 2:138341620-138341642 AAAACTACTAAGATTTGATATGG + Intergenic
943881446 2:193149633-193149655 CCATCTAGTAGCTTTTTATAAGG - Intergenic
947967091 2:234290671-234290693 ACATTTACTTGCTTTTGCTAAGG + Intergenic
1169716680 20:8627336-8627358 ACATCTACTATTTCTTCATAAGG + Intronic
1172808106 20:37627598-37627620 ACAGCTGCTAGGTTCAGATAAGG + Intergenic
950865552 3:16185924-16185946 AAATCTACTAAGTTTTGATAAGG - Intronic
951695603 3:25442880-25442902 ACACCTGCTTGGTTTTGAGATGG + Intronic
955709324 3:61762248-61762270 CCATCTACTAGGGTGTGAAAAGG + Intronic
957164877 3:76659600-76659622 ACATCTATTAGGTTTTGTCTTGG - Intronic
961087481 3:124081461-124081483 ACCTCTTTTATGTTTTGATAGGG - Intronic
962822269 3:139061366-139061388 ATACCTACTGGATTTTGATAAGG + Intronic
962824246 3:139084908-139084930 GCATCTACTAGGTGTGGACATGG + Intronic
964145185 3:153452298-153452320 TCATCTCACAGGTTTTGATATGG - Intergenic
964845489 3:161040037-161040059 AAATCTACTGGGTTTGGATGTGG + Intronic
966802178 3:183774520-183774542 ACTTCTGCTAGGTTTGGAGATGG + Intronic
969998588 4:11340837-11340859 AGATCTACAAGGTTTTGAAATGG - Intergenic
974766277 4:66350385-66350407 GTATCCAATAGGTTTTGATATGG - Intergenic
976082510 4:81371642-81371664 AAATCTACTAAGTTTTGGTTTGG + Intergenic
977449764 4:97180036-97180058 TCATATATTAGGTTTTGCTATGG + Intergenic
978633901 4:110780755-110780777 ACATCTACTGGCTGTTGATGTGG + Intergenic
978672564 4:111268153-111268175 ACACTCACTAGGTGTTGATAAGG + Intergenic
980954179 4:139411242-139411264 AGATCTAGTAGGATTTGGTAAGG + Intronic
984694297 4:182764177-182764199 AAACCTCTTAGGTTTTGATAAGG + Intronic
986537096 5:8800610-8800632 ACATCCAATAGGTTTTGGTAAGG - Intergenic
991267722 5:64742306-64742328 ACATGTACTAGGTTTTCTTTAGG + Intronic
994248137 5:97504484-97504506 AAATTTAGTAGGTTTTGAGAAGG + Intergenic
995122231 5:108548465-108548487 ACATCTGCTAGATTTTATTAGGG - Intergenic
996861282 5:128069166-128069188 ACATCTGCTAGTCTCTGATAGGG + Intergenic
997753312 5:136371073-136371095 ACAGCTGCTAGCTTTTAATATGG - Intronic
998056309 5:139081216-139081238 ACATCTAATTGTTTTTGAAAGGG - Intronic
999039400 5:148390307-148390329 ACATCTACTTGGACTTGAGAAGG + Intronic
1001931421 5:175675799-175675821 ACATCTATTAGGTTTTGAGTAGG + Intronic
1002156894 5:177289345-177289367 ACATTGAATAGGTGTTGATAGGG + Intronic
1004466036 6:15885824-15885846 ACATCTACCAGGTTATAACAGGG + Intergenic
1006889392 6:37412718-37412740 ACATCCACTAGGATTTGAATAGG + Intergenic
1008498680 6:52157975-52157997 CCATCTGCTAGGTTTTTATCAGG - Intergenic
1008602070 6:53106245-53106267 GCATCTACTAGGTTTGAATTGGG - Intergenic
1012245294 6:96919501-96919523 ACTTCTACCAGGTTTATATATGG + Intergenic
1014195580 6:118554675-118554697 ACCTCTACTGGTTTTTAATAGGG - Intronic
1014461241 6:121698403-121698425 AAATCTACTAAATCTTGATAAGG + Intergenic
1021899478 7:25269246-25269268 ACATCTTCTGGTTTTTGAAATGG - Intergenic
1023732099 7:43202108-43202130 ACATCTACTTGTATTTCATAGGG - Intronic
1024190925 7:47008909-47008931 ACATCTTCGAGGTTTTATTATGG - Intergenic
1034237230 7:149581493-149581515 ACATCCTCTAGTTTTTGAGATGG - Intergenic
1034240247 7:149604908-149604930 ACATCCTCTAGTTTTTGAGATGG - Intergenic
1036109426 8:5880994-5881016 ACATCTACTTTTTTTTGATTTGG - Intergenic
1037108171 8:15136028-15136050 ACAGCTTCTAGGTGTTGACAGGG + Intronic
1037171170 8:15894057-15894079 ACTTCAGCAAGGTTTTGATAAGG - Intergenic
1042382044 8:68128284-68128306 ACATTAACTAGATGTTGATAGGG + Intronic
1043362803 8:79495365-79495387 TCATCTACTAGGTTTGGGTTTGG + Intergenic
1043657515 8:82688332-82688354 TCTTCTACTAGTTTTGGATATGG - Intergenic
1044033113 8:87262849-87262871 ACATCTACTATGTGTTCATTTGG + Intronic
1046679621 8:117154186-117154208 CCATCATCTAGGTATTGATAAGG + Intronic
1046834966 8:118790149-118790171 ACATCTTCTGGGTTTTGATGTGG + Intergenic
1053468444 9:38327188-38327210 ACATTTAATAGGTTTTGGTATGG - Intergenic
1054836201 9:69676556-69676578 ATATCTTCCAGCTTTTGATATGG + Intergenic
1055237171 9:74137060-74137082 AAATCAACTAGTTTTTCATATGG + Intergenic
1055862205 9:80765322-80765344 AAATCTTCTAGATATTGATATGG - Intergenic
1187095745 X:16146215-16146237 ACATCTAATTGTTTTAGATAAGG + Intronic
1193550796 X:82890539-82890561 ACATCTACTATTTTTTATTATGG - Intergenic
1194070567 X:89320571-89320593 GTATCTCCAAGGTTTTGATATGG + Intergenic
1197442149 X:126505109-126505131 AAATCTACTAGGATCTGGTAGGG + Intergenic
1197644913 X:129006783-129006805 ATATCTACCAGGTTTTGCTGGGG - Intergenic
1200724809 Y:6656310-6656332 GTATCTCCAAGGTTTTGATATGG + Intergenic