ID: 1157568357

View in Genome Browser
Species Human (GRCh38)
Location 18:48695878-48695900
Sequence AGGGAACTTCCTGCCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157568357 Original CRISPR AGGGAACTTCCTGCCATTGT TGG Intronic
900776690 1:4591069-4591091 AGGGAATTTCCTGGCATGGAAGG - Intergenic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
903037187 1:20500514-20500536 AGGCAGCATCCTGCCATTGGAGG + Exonic
905301290 1:36987750-36987772 CGTGACCTTCCTGCTATTGTCGG - Intronic
907252507 1:53150286-53150308 TGGGAACTTACAGACATTGTGGG - Intergenic
911159140 1:94667018-94667040 TGTGAACTTCAAGCCATTGTAGG + Intergenic
911783465 1:101913478-101913500 TGGGAACGTTCTGCCATTATTGG + Intronic
911975995 1:104495750-104495772 AGGGAACTCCCATACATTGTTGG + Intergenic
912589552 1:110802465-110802487 AGGGGACATCCTGGCAGTGTGGG - Intergenic
913263988 1:117026543-117026565 ATGGGACTTCCTGTAATTGTTGG - Intronic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
916825753 1:168440345-168440367 AGGGTCCTCCCTGCCATTTTAGG + Intergenic
917725631 1:177824878-177824900 AGGGAAGTTCATGCCATGTTTGG - Intergenic
918229855 1:182518362-182518384 AGGGAATATCCTGGCAGTGTGGG + Intronic
920827836 1:209438310-209438332 AGGAAAGTTGCTGCCATTGCTGG - Intergenic
921197519 1:212773561-212773583 AGGGAACTTTTAGACATTGTTGG + Intronic
923071659 1:230570833-230570855 AGGGATCTTTGTGCCATTCTGGG - Intergenic
1068010243 10:51439715-51439737 AGAGAACATCCTGCCCTTGAGGG - Intronic
1070074128 10:73118634-73118656 AGGGAACATCCTCCTATTCTTGG - Intronic
1071786399 10:88905059-88905081 AGATGAATTCCTGCCATTGTAGG - Intronic
1073886203 10:108042776-108042798 ATGAAACAACCTGCCATTGTGGG - Intergenic
1075151242 10:119934671-119934693 AAGGAAGTTCCTGCCATTTTTGG + Intronic
1075733342 10:124649318-124649340 AGAGGCCTTCCTGCTATTGTTGG + Intronic
1076627248 10:131829627-131829649 GGGGAGCTTCCTGCCAGGGTGGG - Intergenic
1080192493 11:29568873-29568895 AGGGAATATCCTGACAGTGTGGG - Intergenic
1083350202 11:62022577-62022599 ATGGAACTTCATGCCCTTTTTGG - Intergenic
1084707683 11:70824784-70824806 CGGGAACTGCCTGTCATTGGAGG + Intronic
1086226686 11:84520084-84520106 AGTGAGCTTCCTGTCATTGGAGG - Intronic
1086431105 11:86737891-86737913 AGACAACTTCCTTCCTTTGTTGG + Intergenic
1088750925 11:112841634-112841656 AGGGAACTACCTGCCTTTTGTGG - Intergenic
1089292851 11:117448787-117448809 TGAGAACAGCCTGCCATTGTTGG - Intronic
1090864393 11:130684935-130684957 TTGGAACATCCTTCCATTGTAGG - Intronic
1091053708 11:132398866-132398888 AGAGACCTTCCTGCCTATGTCGG - Intergenic
1091202588 11:133793483-133793505 AGGGAATTTCCTTCCTTTCTTGG + Intergenic
1093173648 12:15886430-15886452 AAGAAACATCCTGCCATGGTGGG - Intronic
1098736512 12:74112285-74112307 AGGGAACTTACTGCCATGAAGGG - Intergenic
1098753607 12:74328259-74328281 AGTGAAGTTACTGTCATTGTAGG + Intergenic
1100348645 12:93756803-93756825 AGGGAACTTCCAGGCAGTGCAGG + Intronic
1101947339 12:109147600-109147622 ACGGAACTTGCTTCCAGTGTAGG - Intronic
1103465125 12:121136281-121136303 ATGGGACTTCCTGACATTCTTGG + Intronic
1105277348 13:18943768-18943790 AGGGGACTTCTTGCCACTTTGGG + Intergenic
1105916417 13:24921202-24921224 AGGTAACTTGCTGCAATTGTAGG + Intronic
1107337331 13:39369226-39369248 AGGGAAATTCAAGCAATTGTGGG - Intronic
1112409790 13:99153064-99153086 ATGGAACTGCCTGCCATTCTGGG + Intergenic
1118473670 14:66098111-66098133 AGGGAACTAACTGACTTTGTTGG - Intergenic
1118473672 14:66098131-66098153 AGGGAACTGACTGACTTTGTAGG - Intergenic
1121327936 14:93032634-93032656 GGGGGACTTCCTCCCATTGAGGG - Intronic
1123489049 15:20765289-20765311 AGGGGACTTCCTGCCAGGCTGGG - Intergenic
1123545548 15:21334376-21334398 AGGGGACTTCCTGCCAGGCTGGG - Intergenic
1124655188 15:31501795-31501817 AGGGATCTACCTGCCCTTGGAGG - Exonic
1125981936 15:44010171-44010193 AGGGAACTTTCTGCCATGGATGG + Intronic
1126331854 15:47541117-47541139 AGGGAGCTTTCTGACATTCTTGG + Intronic
1128801416 15:70499444-70499466 AGGGGCCTGTCTGCCATTGTTGG - Intergenic
1130042139 15:80413871-80413893 AGGCAACTTCCTGCCTGTTTTGG + Intronic
1202953893 15_KI270727v1_random:61646-61668 AGGGGACTTCCTGCCAGGCTGGG - Intergenic
1133389140 16:5395126-5395148 AGGGAACTACCTGCCAGTTTTGG + Intergenic
1135543603 16:23351155-23351177 AGGGTTCTTCCTGCCTTGGTGGG + Intronic
1136455017 16:30375581-30375603 AGGAAGCTTCCACCCATTGTGGG + Intronic
1145290746 17:21543872-21543894 TGGGAACTTACTGGAATTGTTGG - Intronic
1146541287 17:33697629-33697651 AGGGCAGTTACTGCCATGGTTGG - Intronic
1148537981 17:48456595-48456617 AGTGAATTTCCTTCCCTTGTGGG - Intergenic
1151688558 17:75665124-75665146 AGGGATTTTCCTGCCCCTGTGGG + Exonic
1155156538 18:23162542-23162564 AGGGAACTTACAGTCCTTGTAGG + Intronic
1156016397 18:32551864-32551886 AAGTCACTTCCTGCCATTGCAGG - Intergenic
1156208029 18:34907054-34907076 AGGAAACTTCCAGCCATGGCAGG + Intergenic
1157568357 18:48695878-48695900 AGGGAACTTCCTGCCATTGTTGG + Intronic
1160001094 18:75023632-75023654 AGCTGACTTCCTGCCACTGTGGG - Intronic
1160021241 18:75183585-75183607 AGGGAACTCCTGGCCATGGTGGG - Intergenic
1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG + Intergenic
1160944866 19:1636973-1636995 AGGGCACGTCCTGCCACTTTAGG - Intronic
927883574 2:26705470-26705492 AGGTCACTTCCTGCAATTGAGGG + Intronic
927919591 2:26961736-26961758 ATGGATCTTCCTGGCATTTTCGG - Intergenic
928317636 2:30258438-30258460 AGAGCACTTCCTGCCCTTGTTGG + Exonic
935637718 2:105262419-105262441 AGGAAGCTTCCAGCCATGGTGGG - Intergenic
935659629 2:105454945-105454967 AGGCATCTTCATGCCATAGTGGG + Intergenic
936785309 2:116087567-116087589 GGGGTCCTTCCTGCCTTTGTAGG - Intergenic
937346644 2:121130233-121130255 CTGGAACTTCCTGCCATCATGGG - Intergenic
938753424 2:134357271-134357293 AGGGAACTTACTCACATTTTTGG + Intronic
939011476 2:136851833-136851855 TGGAAATATCCTGCCATTGTGGG + Intronic
940135660 2:150433251-150433273 AGGGGACTTCCTGCCTATGTTGG - Intergenic
940314495 2:152313235-152313257 AGGGAACTCCCATACATTGTTGG - Intergenic
942001503 2:171652703-171652725 AGGGAACCTCCTGCCTTTAAGGG - Intergenic
945890346 2:215424246-215424268 GTAGAACGTCCTGCCATTGTAGG + Exonic
948722556 2:239910832-239910854 ACTGGACTTCCTGCCATGGTGGG - Intronic
1169445476 20:5667698-5667720 AGGGACTTGCCTACCATTGTTGG + Intergenic
1171258567 20:23710822-23710844 AGGGCACTACCTCCCAGTGTAGG + Intergenic
1171265863 20:23772124-23772146 AGGGCACTGCCTCCCAGTGTAGG + Intergenic
1174231055 20:49045981-49046003 AGAGAACTTCCTGCCCCTCTTGG - Intergenic
1174895947 20:54450069-54450091 AGTGACCTTCCTGCTTTTGTAGG + Intergenic
1177962964 21:27691743-27691765 ATGGAATTTCCTTCCAGTGTAGG + Intergenic
1179015644 21:37592662-37592684 AAGGAGCTTCCAGCCACTGTGGG - Intergenic
1181765696 22:25090313-25090335 TGAGAACAGCCTGCCATTGTGGG - Intronic
1182705994 22:32280770-32280792 AGTGAGCTCCCTGCCATTGGTGG + Intergenic
1184394317 22:44223849-44223871 AGTGAGCTCCCTGCCATTGGTGG + Intergenic
953474637 3:43195001-43195023 AGGGAATTTCCCCCCATTCTGGG - Intergenic
953549161 3:43887235-43887257 AGGTAAGTGCCAGCCATTGTGGG - Intergenic
953983595 3:47425475-47425497 AGGGACCTACCCGCCATTGAGGG + Exonic
955971475 3:64442538-64442560 ATGGCACTTCCAGCCATTGCTGG - Intronic
958421621 3:93937891-93937913 AGGGTTCTTCCTTTCATTGTAGG - Intronic
958465490 3:94452828-94452850 AGCAAACTTCTTGCCATTTTTGG + Intergenic
958891790 3:99791754-99791776 GTGGAGCTTCCTGCCATTGTAGG - Intronic
959336516 3:105072248-105072270 AAGGAACTTCCAGCTTTTGTTGG - Intergenic
960601505 3:119463410-119463432 AGGGAACTCCCTCCCAGCGTTGG + Exonic
961503173 3:127351682-127351704 AGAGAACTTTCAGGCATTGTAGG - Intergenic
961812523 3:129530074-129530096 AGGGAATCTCTGGCCATTGTTGG + Intronic
963972005 3:151440408-151440430 AGAGAACTTCCTTCCATACTTGG - Intronic
964253776 3:154750672-154750694 GGGGAACTTGCTGCCATTAAAGG + Intergenic
964477840 3:157112547-157112569 AGGAAGCTGCCTGCCAGTGTGGG + Intergenic
965236728 3:166134778-166134800 AGGGAAATTCTAGGCATTGTTGG - Intergenic
966891936 3:184413520-184413542 AGGGACCTGGCTGCCAGTGTTGG + Intronic
970139362 4:12964631-12964653 AAGGAAGTTCATGTCATTGTTGG + Intergenic
977787945 4:101061577-101061599 AGAGAACTTCACGCCATTATAGG + Intronic
984947505 4:184981437-184981459 ATTGAACTTCCTGCCATGGCGGG + Intergenic
993486276 5:88490655-88490677 TGTGAACTTCCTGCTATTGAAGG + Intergenic
994852261 5:105070816-105070838 AAGGCATTTCCTGCCATTCTAGG - Intergenic
996525441 5:124474315-124474337 AGGGAACTTCCTGAGAGTGAAGG - Intergenic
999184419 5:149695342-149695364 AGGGATCTTCCTGCCATATCCGG - Intergenic
1003237763 6:4313200-4313222 AGGGGACATCCTGGCAGTGTGGG + Intergenic
1003316060 6:5013035-5013057 TGGGAACTTGCTGGAATTGTTGG + Intergenic
1009323526 6:62320971-62320993 TGGGAACTCCCATCCATTGTTGG + Intergenic
1011646524 6:89464229-89464251 AGTGAAGTTCCTGCCAGTGGAGG - Intronic
1011987835 6:93472675-93472697 AGAGACCTTCCTGCCATTCCAGG - Intergenic
1012905066 6:105054740-105054762 AGGGGACTTCTTGCCACTTTGGG + Intronic
1013971515 6:116025496-116025518 AAGGAAATTCCTGCCACTGATGG + Intronic
1014222148 6:118808534-118808556 AGGGATCTTGCTGCCTTTGAGGG - Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1024418062 7:49131473-49131495 AAGGAAGTTCCTGCTATTGAAGG + Intergenic
1026060631 7:67022508-67022530 ACGGAACTTCTTGCAATTCTAGG + Intronic
1029835557 7:103305906-103305928 TGGGACCTCTCTGCCATTGTTGG + Intronic
1031371982 7:120979169-120979191 ATGGAACTTATTGCCAGTGTGGG + Intergenic
1031652746 7:124311234-124311256 AGGGAACTACCAGGCACTGTAGG + Intergenic
1032953454 7:136943085-136943107 AGGGAGCTTCCTGACACTGGAGG - Intronic
1034956916 7:155340481-155340503 AGGGAACTCACTGCCTTTCTTGG + Intergenic
1041829044 8:62132077-62132099 AGAGAACTTCTAGCCATTGGGGG + Intergenic
1042836405 8:73082681-73082703 AGGTCACTTCCTGCTTTTGTTGG + Intronic
1043090150 8:75891310-75891332 AGGGGACTTCCTACCATTACAGG + Intergenic
1044722896 8:95167898-95167920 AGGGAAATCCCTACCACTGTGGG - Intergenic
1050913058 9:11099484-11099506 AGGGAGTTGCATGCCATTGTAGG - Intergenic
1051773500 9:20606831-20606853 AGAGAACTACTTGACATTGTGGG - Intronic
1053415076 9:37942333-37942355 TGGGACCTTCCTGCCATCCTTGG + Intronic
1055503215 9:76922459-76922481 GGGGATCTTCCTGACCTTGTTGG - Intergenic
1056254157 9:84781235-84781257 AGGGCAATTCCTGCCTCTGTAGG + Intronic
1059453161 9:114383420-114383442 AGGGAGCTCCCTGCCATGGAGGG + Intronic
1059509028 9:114826766-114826788 AAGGAACTTCCTTCCATGGGGGG - Intergenic
1187401913 X:18967608-18967630 GGGGAATTTCCTTCCATTCTAGG + Intronic
1189691041 X:43617114-43617136 GGGTAACTTCCTGACATTGCCGG + Intergenic
1191252535 X:58266404-58266426 GGGAAACTTCCTGCCACTCTGGG + Intergenic
1191255616 X:58278338-58278360 AGGAAACTTCTTGCCACTTTGGG + Intergenic
1192559382 X:72115690-72115712 AGTGGATGTCCTGCCATTGTGGG + Intergenic
1194740431 X:97566398-97566420 GGTGAAGTTCCTGCCATTATAGG + Intronic
1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG + Intergenic
1195807203 X:108787761-108787783 AGGGAACTCTCTTCCACTGTTGG - Intergenic
1200231420 X:154445649-154445671 AGAGAACTTCTTGTCAATGTTGG - Exonic