ID: 1157569853

View in Genome Browser
Species Human (GRCh38)
Location 18:48705083-48705105
Sequence ACTGTGGTCTCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157569843_1157569853 28 Left 1157569843 18:48705032-48705054 CCTTTTCCAGCCTCTGAAGGAAT 0: 1
1: 0
2: 2
3: 30
4: 323
Right 1157569853 18:48705083-48705105 ACTGTGGTCTCCAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 395
1157569845_1157569853 22 Left 1157569845 18:48705038-48705060 CCAGCCTCTGAAGGAATTGGTCT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1157569853 18:48705083-48705105 ACTGTGGTCTCCAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 395
1157569846_1157569853 18 Left 1157569846 18:48705042-48705064 CCTCTGAAGGAATTGGTCTATGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1157569853 18:48705083-48705105 ACTGTGGTCTCCAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157569853 Original CRISPR ACTGTGGTCTCCAGGGAAGC AGG Intronic
900833632 1:4983676-4983698 ACTGTCGTCTCAAGGGAACCTGG - Intergenic
901219600 1:7575898-7575920 CCTGACGTCTCCAGGGAAGCAGG - Intronic
903564164 1:24252336-24252358 ATTGCGGGCTCCAGGGAGGCAGG - Intergenic
903747309 1:25596464-25596486 ATTGTGGTGGCCAGGGAAGAGGG + Intergenic
904195438 1:28781975-28781997 ACTGTGGCCTCCAGACATGCAGG + Intergenic
905452024 1:38063071-38063093 AATGTGGTCGCCAGGTGAGCAGG + Intergenic
905894537 1:41536576-41536598 ACTGTGGTGACCTGGGAGGCAGG + Intronic
906051720 1:42880144-42880166 ACTGTGGGCTCCAGGGAATGTGG + Intergenic
906213421 1:44024792-44024814 AGTGTGGGCTCCAGGGCAGCTGG + Intronic
907339671 1:53726011-53726033 ACTGTGGGCTTCTTGGAAGCAGG - Intronic
910207013 1:84758346-84758368 GCTTTGGTCTCCAGGCATGCCGG + Intergenic
910708530 1:90155138-90155160 ACTGCGGGCTGCATGGAAGCAGG - Intergenic
911819554 1:102400153-102400175 ACTGTGGTCTCCAGCAGACCGGG - Intergenic
912548897 1:110471566-110471588 ACTGGGGGCTGCAGGGAAGTGGG - Intergenic
912616174 1:111102217-111102239 ACTTTGGTTTGCATGGAAGCTGG - Intergenic
912707139 1:111923315-111923337 ACTGTGCTGGCAAGGGAAGCAGG - Intronic
913236184 1:116785280-116785302 ACACAGGTCTCCAGGGAAGTGGG - Intergenic
913319153 1:117576499-117576521 CCAGTGGTCTCCAGGGATGGGGG - Intergenic
914761459 1:150602155-150602177 ACTTTGGCCTCCAGAGTAGCTGG - Intronic
915279756 1:154814369-154814391 ACTGTGGGCTCCATGGCAGTGGG - Intronic
915596609 1:156899992-156900014 AGTGTGGGCTCTAGGGGAGCAGG - Intronic
916861421 1:168809721-168809743 GATGTGGTATCCAGTGAAGCAGG - Intergenic
917200926 1:172514616-172514638 ACTCTGGTCCCCAGGCAAGAAGG - Intergenic
917436173 1:175023520-175023542 AATGTGGCCTACAGGAAAGCGGG + Intergenic
917971679 1:180211901-180211923 ACTGTGAACTCCAGGAAGGCAGG + Intergenic
919663306 1:200269069-200269091 ACTTTGGTCTCCAGAATAGCTGG + Intergenic
919797565 1:201330607-201330629 CCAGTGGTCTCCAGGGGTGCAGG + Exonic
919857568 1:201716173-201716195 GCGGGGATCTCCAGGGAAGCTGG - Intronic
923092412 1:230750581-230750603 ACAGAGGTCTGCAGGGAACCTGG - Intronic
923591360 1:235322688-235322710 ACTGTGGGCTCCCTGAAAGCAGG + Intronic
923643076 1:235785356-235785378 ACTGTGAACTCCAGGAAGGCAGG + Intronic
924595618 1:245442473-245442495 AATGTGGTCCTCAGGGAAACTGG + Intronic
1063085972 10:2817984-2818006 TCTGTGATCTCCGGGGCAGCAGG - Intergenic
1063476512 10:6333328-6333350 GCTGTGGGCTCCGGGCAAGCTGG + Intergenic
1066298916 10:34079855-34079877 AGTGTGGACTCCAGGGAAGCAGG + Intergenic
1067079388 10:43204715-43204737 ACTGGAGTCTCGTGGGAAGCTGG + Intronic
1069793805 10:71039951-71039973 ACTGTGGGACCCAGGGAAGCAGG - Intergenic
1069877788 10:71573811-71573833 TCTGTGGGCCCCAGGGGAGCCGG - Intronic
1069886538 10:71627456-71627478 CCTCTGGTCCCCAGGGAGGCTGG - Intronic
1071553542 10:86585464-86585486 ACTGTGGGCTCCTGGAAGGCAGG + Intergenic
1072370990 10:94766303-94766325 ATTGAGGTATCCAAGGAAGCAGG + Intronic
1072805788 10:98423504-98423526 ACTATGGGCCCCAGGGAAGGGGG - Intronic
1073583536 10:104688211-104688233 AGGGAGGTCTCCAGTGAAGCAGG + Intronic
1074126937 10:110536087-110536109 ACTGGTGTCTCCAGGGAACTGGG - Intergenic
1075847657 10:125558065-125558087 ACTGTGGATTCCAGGAAGGCAGG + Intergenic
1076220310 10:128728482-128728504 AAGGTGGCCTCCACGGAAGCAGG - Intergenic
1077217630 11:1401613-1401635 TCTCTGGTCTCCAGGGAAGGCGG + Intronic
1077484501 11:2832600-2832622 ACTGTGGTCTCCCAGGCAGCAGG - Intronic
1077555868 11:3225765-3225787 TCTGAGGTCTCCATGGAAACTGG - Intergenic
1078468354 11:11567537-11567559 ACTATGCTTTTCAGGGAAGCAGG - Intronic
1078495600 11:11813426-11813448 ACTGTGGTATTCAGTGAAGCTGG + Intergenic
1078729991 11:13964782-13964804 CCTGTGGACCGCAGGGAAGCGGG + Intronic
1079400838 11:20105092-20105114 ACTGTGAGCTCCTGGGAACCAGG + Intronic
1081779939 11:45703235-45703257 ACTGTAAGCTCCAGGAAAGCAGG + Intergenic
1083182571 11:60996623-60996645 ACGGTGGTCTGCAGGTTAGCAGG + Intronic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1085514942 11:77106433-77106455 CCTGTGGTTTCCAGGGAAAATGG - Intronic
1085837182 11:79969633-79969655 ACTCTGAGCTCCTGGGAAGCAGG + Intergenic
1086844340 11:91730215-91730237 ACTGTGGGCAGCATGGAAGCAGG + Intergenic
1087164357 11:94986113-94986135 AATGTGGTCTCCAGGTCTGCAGG - Intronic
1088504742 11:110516782-110516804 GCTGTGGTGGCCAAGGAAGCTGG - Intergenic
1088927869 11:114320585-114320607 ACTGTGGGCTCCAGGAAGTCAGG - Intergenic
1090967028 11:131607789-131607811 ACTGTAGACTCCAGGAAGGCAGG + Intronic
1091581394 12:1792585-1792607 ACTGTTGTCTCCTGGGATCCAGG + Exonic
1092529410 12:9332097-9332119 ACTGTGGTCTCAACTGAAACTGG + Intergenic
1092968869 12:13672398-13672420 TCAGTGGACTCCAGGGAGGCAGG - Intronic
1095297429 12:40542840-40542862 AATGTTGTCTACTGGGAAGCAGG - Intronic
1095964765 12:47859175-47859197 ACTCTGGTCCCCAGGTGAGCAGG - Intronic
1096800537 12:54107438-54107460 ACTCGGGTCTCCAGGCAAGTCGG - Intergenic
1097340640 12:58434003-58434025 ACTCTGGTCTCCCGTGTAGCTGG - Intergenic
1098075774 12:66729135-66729157 ACCTTGGCCTCCAGGGTAGCTGG + Intronic
1099574275 12:84361675-84361697 ACGGTGGTCCCCTGGGCAGCAGG - Intergenic
1100661242 12:96701446-96701468 ACTGTAAGCTCCAGGAAAGCAGG - Intronic
1100805800 12:98282333-98282355 AATGTGTTCTGCAGGGAAGGAGG - Intergenic
1101118518 12:101555041-101555063 ACTGTGGACTCCCGGCAGGCAGG + Intergenic
1101738219 12:107479573-107479595 ACAGTGATCTCCAGAGAAGAAGG - Intronic
1101794586 12:107961124-107961146 AGTGAGGTCTTCTGGGAAGCCGG - Intergenic
1101850051 12:108394465-108394487 CTTGAAGTCTCCAGGGAAGCTGG - Intergenic
1102269056 12:111515197-111515219 ACAGTTTTCTCCAGGGAAGCAGG + Intronic
1102918198 12:116771343-116771365 ACCCTAGTCTCCAGGGTAGCGGG - Intronic
1102932770 12:116875385-116875407 AATGTGGGCTCCATGAAAGCAGG + Intronic
1103467356 12:121152441-121152463 ACTGTGGCCTCCAGAGTAGCTGG + Intronic
1103486021 12:121283154-121283176 TCTGTGGCCTCCAAGGCAGCCGG - Intronic
1103890996 12:124239054-124239076 ACTCTGCCCTCCAGGGAAACAGG - Intronic
1104144960 12:126024353-126024375 ACCTTGGCCTCCAGGGTAGCTGG - Intergenic
1104742693 12:131189984-131190006 ACTGTGGGCACCAGGGAACATGG - Intergenic
1104787148 12:131457131-131457153 GCTGGGGTCTCTGGGGAAGCTGG - Intergenic
1104805291 12:131586005-131586027 ACAGTGGTCCCCAGGGTAGTAGG - Intergenic
1105628785 13:22140537-22140559 ACTGTGGTCTGCACTGAAACAGG - Intergenic
1106079457 13:26488212-26488234 TGTGAGGTCTCCAGGGAAGGAGG + Intergenic
1106108395 13:26755587-26755609 ACTGTAGGCTCCAGGCAAGGAGG + Exonic
1106284649 13:28308202-28308224 ACTGTGATCTCCAGATAGGCAGG - Intronic
1106667304 13:31865235-31865257 AATGAGTTCACCAGGGAAGCTGG - Intergenic
1107070044 13:36259101-36259123 ACTGTGGTATCCGAGGGAGCAGG - Intronic
1107453971 13:40537374-40537396 ACCGGGGTCACCTGGGAAGCAGG - Intergenic
1108108307 13:47037859-47037881 GCAGTGGTATCCAGGGAGGCTGG + Intergenic
1108618608 13:52159542-52159564 ACTAGGGTCGCCGGGGAAGCGGG - Exonic
1108718045 13:53101182-53101204 GCTCTGGTCTCTAGGGAACCCGG + Intergenic
1108844226 13:54659003-54659025 ACTGTGGGCTCCAGGGAACACGG + Intergenic
1109512436 13:63396839-63396861 ACTGTGGGCACCAGGGAATATGG - Intergenic
1111709692 13:91795806-91795828 ACAGTGGTGTCCAGTCAAGCAGG - Intronic
1112278115 13:98039497-98039519 ACAGTGGTCTCCAAGGGAGCAGG + Intergenic
1112711136 13:102130295-102130317 TCTGGTGGCTCCAGGGAAGCTGG + Intronic
1113063575 13:106351355-106351377 ACTGTGATCACCAGGGAAAAGGG - Intergenic
1114329021 14:21617620-21617642 ACGCAGGTCTCCAGGGAAGTGGG + Intergenic
1115524526 14:34266479-34266501 ACACAGGTGTCCAGGGAAGCAGG + Intronic
1116448423 14:45038554-45038576 ACTGTGGGCACCAGGGAATGTGG + Intronic
1116618092 14:47163822-47163844 AATGTTGTTTCCTGGGAAGCAGG + Intronic
1116848135 14:49883483-49883505 ACTCTGGTCTCCAGCACAGCTGG + Intergenic
1118000068 14:61514634-61514656 ACTGCGGTCTCCTGGGAACCTGG + Intronic
1118140221 14:63072410-63072432 GCTGTGGGCTCCATGGGAGCTGG - Intronic
1118643405 14:67815027-67815049 ACTGTGGTTGCCAGGGAACAAGG + Intronic
1120924608 14:89785183-89785205 ACACTGGTCCCCAGGGAAGCTGG + Intergenic
1122540672 14:102496176-102496198 ACTGTGGGTTCCAGAAAAGCAGG + Intronic
1122766389 14:104074071-104074093 TGTGTGCACTCCAGGGAAGCAGG - Intergenic
1122921184 14:104880960-104880982 ACTGTGGGCTCAAGGGGTGCAGG - Intronic
1123023735 14:105413974-105413996 ACTTTGGCCTCCTGGGTAGCTGG + Intronic
1202899016 14_GL000194v1_random:25228-25250 ACTGTGGACTCCAGGGTCCCTGG + Intergenic
1123635316 15:22301866-22301888 ATGGTGGTCTCTTGGGAAGCTGG + Intergenic
1124233253 15:27965098-27965120 ACTGTGATCACCAGGGAGGTTGG + Intronic
1125539982 15:40464665-40464687 ACTTTGGACTCCAGAGAACCTGG + Intronic
1125544889 15:40495981-40496003 TCTGTGGTAGGCAGGGAAGCAGG - Intergenic
1125599464 15:40907384-40907406 GCTGTGGTGGCCAGGGCAGCTGG - Intergenic
1125733672 15:41908937-41908959 ACTGTGGCCCCCAGGGCAGAGGG + Intronic
1126387626 15:48110078-48110100 ACTGTGGTCTACATGGACGTGGG - Intergenic
1126725658 15:51628880-51628902 ACCTTGGTCTCCAGAGTAGCTGG - Intergenic
1126812007 15:52416367-52416389 ACTATGGTCTCTATGGAAGTAGG + Intronic
1127055668 15:55128609-55128631 ACTGTGGTCTGAAAAGAAGCAGG + Intergenic
1128792227 15:70441825-70441847 ACCTTGGTCTCCTGGGTAGCTGG - Intergenic
1130537521 15:84797985-84798007 ACTGTGGTCTGCAGTGCTGCTGG - Exonic
1131226143 15:90625885-90625907 TCGGTGGTGTCCAGGGAGGCTGG - Exonic
1131429383 15:92374577-92374599 AGTGTGGCCCCCAGGGCAGCAGG + Intergenic
1131875030 15:96796766-96796788 ACTGTGGTATCCAGGAGTGCAGG + Intergenic
1132153387 15:99477923-99477945 AGTCTTCTCTCCAGGGAAGCAGG - Intergenic
1132301637 15:100779726-100779748 ACTGGGGACCCCAGGGATGCTGG - Intergenic
1132459387 16:43114-43136 CCTGTGGTCTCTATGGAAGAAGG + Intergenic
1132514394 16:359511-359533 ACTCAGGTCTCCTGGGAGGCAGG - Intergenic
1133245051 16:4443098-4443120 TGTGTGGTCTGCAGGGGAGCAGG + Exonic
1133340940 16:5035532-5035554 ACAGTGGGCTCCATGGAAACCGG - Intronic
1134054671 16:11162224-11162246 ACTGGGGGCTCCTGGGAAGTGGG + Intronic
1135648510 16:24185363-24185385 ACTGTGGGCCCCAGGGAGGAGGG + Intronic
1135909882 16:26550242-26550264 GCTCTAGTCTCCAGGGAAACAGG + Intergenic
1135976326 16:27110810-27110832 GCTGAGGTCACCAGGGATGCTGG - Intergenic
1137037522 16:35579000-35579022 ACTGAGGTTGCCAAGGAAGCAGG - Intergenic
1137396963 16:48123021-48123043 GCTGTGGTCACTGGGGAAGCAGG - Intronic
1137488726 16:48913122-48913144 ACCTTGGTCTCCAGAGTAGCTGG + Intergenic
1137746568 16:50824764-50824786 AGTGTGGTCTCCAGACCAGCAGG - Intergenic
1138202992 16:55103947-55103969 ATTGTGATCTCCATGGAGGCGGG - Intergenic
1138623075 16:58227127-58227149 ACTGTGGCCTCCTGAGTAGCTGG - Intergenic
1138657195 16:58498309-58498331 CCTGTGCTCCCCAGGGCAGCAGG - Intronic
1139429652 16:66904314-66904336 ACTGTGGTCACCAGGACAACGGG - Intergenic
1140530061 16:75657844-75657866 TCTCTGGTCCGCAGGGAAGCTGG - Intronic
1141569462 16:84925463-84925485 AGAGAGGCCTCCAGGGAAGCAGG + Intergenic
1141685158 16:85565898-85565920 CCTGTGGGTTCCAGGGCAGCAGG + Intergenic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1142270389 16:89086001-89086023 ACTGTGGTCACCGGGGAAAATGG + Intergenic
1142595385 17:1027259-1027281 TCTGTGGCCTGCAGGGAGGCCGG + Intronic
1142865664 17:2790073-2790095 ATGCTGGTCTCCAGGGAAACAGG - Intronic
1143122764 17:4619267-4619289 ACTGTAGCCTCCAGAGTAGCTGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144056078 17:11541821-11541843 ACTGAGGTCTCCAGGGTACTAGG + Intronic
1144373173 17:14612697-14612719 ATTTTAGTCTCCAGAGAAGCTGG + Intergenic
1144494028 17:15735937-15735959 ACTGTGGTCTCCAAGTAAGCTGG + Intronic
1144662420 17:17079922-17079944 ACTGTGGTCTCCCAGCAACCTGG + Intronic
1144906232 17:18640742-18640764 ACTGTGGTCTCCAAGTAAGCTGG - Intronic
1145055834 17:19703563-19703585 ACTGCTTTCTACAGGGAAGCCGG + Intronic
1145272323 17:21411348-21411370 ACTGTGGCCAGCAGGAAAGCAGG + Intronic
1145310529 17:21698813-21698835 ACTGTGGCCAGCAGGAAAGCAGG + Intronic
1145915566 17:28571760-28571782 AGTGTGTTCTACAGGGAAGCGGG - Exonic
1146810079 17:35896269-35896291 CCTGTGGGCCCCAAGGAAGCTGG + Intergenic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1146915565 17:36676265-36676287 ACTGAGGCCTCCGGGGAAGGTGG + Intergenic
1147961659 17:44171167-44171189 TCTGTGGTCTGCAGGGAAGGAGG - Intronic
1148196820 17:45720003-45720025 ACTGTGGTTTCCTGGGAGGTAGG - Intergenic
1148400637 17:47357033-47357055 ACTGTGGGCTGCGTGGAAGCTGG - Intronic
1149552699 17:57551963-57551985 GCTGAGGGATCCAGGGAAGCTGG - Intronic
1151182880 17:72342644-72342666 ACTGTGGTCTCCAAGGCAACGGG + Intergenic
1151683092 17:75631894-75631916 ATGGGGGTCTCCCGGGAAGCAGG + Intronic
1151716460 17:75833595-75833617 AACGTGGGCTCCAGGAAAGCAGG + Intronic
1152272767 17:79334680-79334702 ACTGAGCTCTCCAGGGAACCAGG + Intronic
1152329624 17:79664788-79664810 ACAGTGGTCTCCAGGGACCGGGG - Intergenic
1152504131 17:80736055-80736077 ACCTTGGTCTCCAGAGTAGCTGG - Intronic
1152599901 17:81256969-81256991 ACTGCTGTCTCCTGGGAGGCGGG + Intronic
1152811692 17:82385557-82385579 GCTGTGGGCTTCAGGGAAGCGGG - Intergenic
1152941616 17:83175704-83175726 CCTCTGGACTCCAGGCAAGCAGG - Intergenic
1203167658 17_GL000205v2_random:112966-112988 ACTGTGGTCTTAACTGAAGCTGG - Intergenic
1153428717 18:4992463-4992485 ACTGTGGGCACCAGGGAATGTGG + Intergenic
1153608275 18:6855783-6855805 ACTGTGGGCACCAGGGAATGCGG - Intronic
1154316939 18:13311647-13311669 ACTGTGCTCTTGAGGGAAGGCGG + Intronic
1154346509 18:13547694-13547716 ACTGTGGACACCGGGGAAGATGG + Intronic
1155506781 18:26541167-26541189 CCTGTGGGCTGCAGGGCAGCAGG - Intronic
1156111988 18:33739328-33739350 AATGTTGTCTCAAGGGAGGCTGG - Exonic
1156392554 18:36664556-36664578 ACTGTGGGCCCTAGGGAACCTGG + Intronic
1157241098 18:46010141-46010163 CCAGTGGCCGCCAGGGAAGCTGG + Intronic
1157278941 18:46333568-46333590 ACTGCGGGCACAAGGGAAGCTGG - Intronic
1157440312 18:47706464-47706486 AGTGTGGTGTCCAGGGAACAGGG + Intergenic
1157569853 18:48705083-48705105 ACTGTGGTCTCCAGGGAAGCAGG + Intronic
1157607575 18:48935524-48935546 ACTGGGGTCTCCAGGGGCCCAGG + Intronic
1157755309 18:50212210-50212232 AATCTGGTCTCCAGGAAACCTGG - Intergenic
1157818817 18:50750651-50750673 ACAGTGGACTGAAGGGAAGCAGG + Intergenic
1158373838 18:56840702-56840724 ACTGTAGCCTCCAGAGTAGCTGG - Intronic
1158783847 18:60685293-60685315 GCTGTGCTCTCCCAGGAAGCTGG - Intergenic
1160238039 18:77101218-77101240 CCTGGGTTCTCCAGGGCAGCTGG + Intronic
1161205707 19:3040214-3040236 AATGAGCTCTCCAGGGAAGGAGG - Intronic
1161233374 19:3186489-3186511 ACTTAGGGCTCCAGGGACGCGGG - Intronic
1161827666 19:6579629-6579651 ACTGTGGTTACCAGGGAATAGGG + Intergenic
1161934908 19:7365597-7365619 ACGGTGGGCTCTGGGGAAGCAGG + Intronic
1163139913 19:15340550-15340572 GCCGTGGTCTCCCAGGAAGCTGG + Intergenic
1163712999 19:18857919-18857941 TCTGTGTTATCCAGGGAAGCCGG - Intronic
1163721500 19:18900178-18900200 ATTGTGGTGTTCAGGGGAGCAGG + Intronic
1164572123 19:29382082-29382104 ACTGGGGTCCCCAGGCAGGCTGG - Intergenic
1165096858 19:33414177-33414199 AGGGTGGTCTCCAGGGATGTGGG + Intronic
1166288532 19:41847349-41847371 GGTGTGGTCTCCAGGGCAGGAGG + Intronic
1166302908 19:41922276-41922298 ACTGTGCTCAGCAGGGAATCAGG + Intronic
1166512421 19:43418079-43418101 ACTGAGCTCTCCAGGGATGAGGG + Intronic
1167510215 19:49891781-49891803 ACTGTGAGCTCCATGGAGGCAGG + Intronic
1167660865 19:50795107-50795129 ACCCTGGTCTCCAGGCCAGCAGG - Exonic
1167704227 19:51069196-51069218 AGTGTGGGCTCCAGGGAGGACGG - Intergenic
1167763166 19:51462047-51462069 ACTGTCCACACCAGGGAAGCAGG + Intergenic
1167765463 19:51479501-51479523 ACTGTGGGCTCCAGGAGGGCAGG - Intronic
925042031 2:739908-739930 ACTGCGGGCACCAGGAAAGCTGG + Intergenic
925722298 2:6841038-6841060 ACTGCAGTCTTCAGGGAAGGTGG - Intronic
925855630 2:8126493-8126515 ACTGTGACCTCCAAGGGAGCAGG + Intergenic
926304767 2:11629882-11629904 CCTGGGGTCTTCTGGGAAGCAGG + Intronic
926416453 2:12654486-12654508 GCTGTGGTCTCCAGGGTTGGGGG - Intergenic
926479620 2:13376190-13376212 ATGGTGGTCTCTTGGGAAGCTGG + Intergenic
929549965 2:42883819-42883841 ACAGAGCTCTCCAGGGATGCTGG - Intergenic
929954207 2:46443121-46443143 ACTGTTTTCTCCAGGGAGACGGG - Intronic
930025354 2:47026082-47026104 AATGAGGTCTCCAAGGAAACTGG - Intronic
930167185 2:48214585-48214607 ACTCTGGTCTCCAGCACAGCTGG - Intergenic
930258878 2:49122399-49122421 ACTGTAGTAACCATGGAAGCTGG - Intronic
931303423 2:61003657-61003679 ACCTTGGTCTCCAGGGTAGCTGG + Intronic
932017239 2:68043212-68043234 ACTATGAACTCCAGGCAAGCAGG - Intronic
933117735 2:78496052-78496074 CCTGTGGTCTAGAGGGAGGCAGG + Intergenic
933789408 2:85872076-85872098 ACTGTGGTGTCCAGGCAGGAGGG + Intronic
933835184 2:86240277-86240299 ACTGTGAGCTCCATGGGAGCAGG - Intronic
934555985 2:95287276-95287298 ACTGTGGCTCCCAGGAAAGCTGG + Intronic
934983776 2:98869504-98869526 ACTGTGCTCACCATGGAAGCAGG + Intronic
935817884 2:106864221-106864243 CCTGTAGTCTCCAGGGCTGCAGG - Intronic
937130719 2:119510412-119510434 ACTGGGGTCCCCAGGGTTGCTGG + Intronic
937265485 2:120612413-120612435 ACAGTTGTGACCAGGGAAGCCGG - Intergenic
937339422 2:121081625-121081647 TCTGTGGTCTGCAGGGCAGTGGG + Intergenic
938341739 2:130540508-130540530 CCTGTGGTCCCCAGGGTGGCTGG + Intronic
938348090 2:130580201-130580223 CCTGTGGTCCCCAGGGTGGCTGG - Intronic
939576383 2:143900469-143900491 ACTGAGGTCTCCTGGGAAAGAGG - Intergenic
939626516 2:144484152-144484174 TCTGAGTTCTCCAGGGGAGCTGG + Intronic
940021730 2:149163066-149163088 AATCTGGGCTCCAGGCAAGCAGG - Intronic
940910945 2:159209539-159209561 ACTGAGGGCCTCAGGGAAGCTGG - Intronic
942248007 2:174025173-174025195 ACAGGGATCTCCAGGGAAGGTGG + Intergenic
944493444 2:200282437-200282459 ACTGGGGTCTCCAGGGTGGAGGG + Intergenic
946415310 2:219537230-219537252 CCCGAGGTCTCCTGGGAAGCAGG - Exonic
948206399 2:236164706-236164728 ACTGAGGGCTGCCGGGAAGCCGG + Intergenic
949015325 2:241706131-241706153 ACTGTGGCCTCCAGGACAGAGGG - Intronic
1169074618 20:2752952-2752974 ACTCAGGGCTCGAGGGAAGCCGG + Intronic
1170585790 20:17732927-17732949 ACCCTGCTCCCCAGGGAAGCTGG - Intronic
1172003519 20:31800725-31800747 ACTGTGGCCTAAAGGAAAGCTGG + Intronic
1172086881 20:32392227-32392249 ACTGCAGTCTCCCGAGAAGCTGG + Intronic
1172115442 20:32570906-32570928 ACTACAGCCTCCAGGGAAGCAGG + Intronic
1172414393 20:34752467-34752489 ACTGTAGGCTCCAAGGATGCAGG - Intronic
1173364668 20:42373994-42374016 ACTGGGGGCTCCAGGGAGGTGGG + Intronic
1173438585 20:43055235-43055257 ACTCTGGTCCCCAGGCATGCAGG + Intronic
1173489262 20:43466268-43466290 GCCTTGGTCTCCAGGGTAGCGGG - Intergenic
1174940408 20:54920425-54920447 ACTGAGGTCTCTAGGAGAGCAGG + Intergenic
1175253617 20:57624775-57624797 ACTGGTGTGTCCAGGAAAGCAGG + Intergenic
1176349628 21:5782221-5782243 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176356442 21:5902805-5902827 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176404100 21:6346170-6346192 ACTGTGGTCTTAACTGAAGCTGG + Intergenic
1176433057 21:6642934-6642956 ACTGTGGTCTTAACTGAAGCTGG - Intergenic
1176543949 21:8180291-8180313 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176562900 21:8363336-8363358 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1177260378 21:18722100-18722122 ACTGTGGTCTCTAGTTTAGCTGG + Intergenic
1179467872 21:41589738-41589760 ACTGTGGGCTGCATGGGAGCAGG - Intergenic
1179953812 21:44726990-44727012 TCTGTGATCTGCAGGGCAGCTGG - Intergenic
1180045437 21:45302995-45303017 GCTGCAGTCTCCAGGGAAGCCGG + Intergenic
1180131006 21:45827101-45827123 CGTGTGGTCCCCAGGGACGCGGG - Intronic
1180182678 21:46124892-46124914 ACCGGGGTCTCCAGGGGGGCCGG - Exonic
1180858356 22:19062365-19062387 CCTCTTTTCTCCAGGGAAGCCGG + Intronic
1181474013 22:23157757-23157779 AGTGTGGGATCCAGGGAGGCAGG - Intronic
1181763298 22:25072814-25072836 ACGGTGGCCTCCTGGGAAGCAGG - Intronic
1183587445 22:38761081-38761103 AGGGTGGTCCCCAGGGAAGCCGG + Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184582960 22:45429566-45429588 CCTCTGGCCTGCAGGGAAGCAGG - Intronic
1184841229 22:47053390-47053412 ACTGTGGCCTCCAGAGGAGGGGG - Intronic
1185237956 22:49725481-49725503 ACTGAGGTTTCCAGGGGAGCAGG - Intergenic
1203248818 22_KI270733v1_random:96513-96535 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
950260820 3:11542569-11542591 ACTGGTGTCTCCAGGGACCCAGG - Intronic
950718333 3:14865193-14865215 GCTGAGGTCTGCTGGGAAGCGGG - Intronic
951231545 3:20185778-20185800 ATTAGGGTCTCCATGGAAGCCGG + Intronic
952508660 3:34032538-34032560 AGTGTGGTCCCCAGTGCAGCAGG - Intergenic
952598471 3:35048512-35048534 ACTGGGGTTTTGAGGGAAGCTGG - Intergenic
953480865 3:43250817-43250839 TCTGAGGTCTCCTGGGGAGCTGG - Intergenic
954388921 3:50258831-50258853 ACTGTGGTTTCCAGGAATGGTGG - Exonic
956576880 3:70761446-70761468 ACTCTGGCCTCCAGGAAACCAGG - Intergenic
956689756 3:71864702-71864724 ACTGTGGTCCCCAGAGAGGGAGG + Intergenic
957515953 3:81251219-81251241 ACTGAGGTCTCCTGGAAAGAGGG + Intergenic
958575139 3:95939555-95939577 ACAGTGGGCTCCACGGAAACTGG - Intergenic
959671937 3:108988166-108988188 ACTGTGCTCTCTCAGGAAGCAGG + Intronic
960845634 3:122002023-122002045 ACCTCGGTCTCCAGAGAAGCTGG - Intronic
962837121 3:139199295-139199317 GCTGTGGGCTCCGGGGAGGCAGG + Intronic
963230490 3:142904569-142904591 AGTGTGGACTCCAGAGAAGATGG + Intergenic
964927730 3:161978144-161978166 ACTGTGGGCTCCAGGGAACAAGG + Intergenic
965132850 3:164723670-164723692 ACTGTGGGCTGCATGGGAGCAGG - Intergenic
965158056 3:165089710-165089732 ACTGTGGTCTCAAATGAACCTGG + Intergenic
967153864 3:186674758-186674780 ACTGAGGTCTCCAGTGCAGAAGG + Intronic
967157436 3:186706262-186706284 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967158455 3:186714511-186714533 ACTCAGGTCTCCAGGGCAGAAGG + Intergenic
967933833 3:194710591-194710613 CCTGTGGTCTCCAAGGGAACTGG + Intergenic
968729989 4:2265061-2265083 ACTGGGCTCCCCAGGGAAGGAGG - Intergenic
968760354 4:2439748-2439770 TTTCTGGTTTCCAGGGAAGCTGG - Intronic
969044845 4:4329218-4329240 ACTCTGCTCTACAGGGGAGCTGG - Intergenic
969162008 4:5268653-5268675 ACTGTAATCTCCAAGGATGCAGG + Intronic
969680430 4:8640192-8640214 AGCGTGGTCCCCAGGGATGCTGG - Intergenic
969912349 4:10457730-10457752 ACTGCAGGCTCCAGGGAGGCAGG - Intergenic
969928911 4:10611527-10611549 TCTGCAGTCTGCAGGGAAGCTGG + Intronic
973676069 4:53264102-53264124 ACTGTAGTCTACATGGGAGCGGG - Intronic
973785772 4:54331597-54331619 ACATTGGTCTCCCAGGAAGCAGG - Intergenic
974879994 4:67743449-67743471 ACTGTAGTCTCCATGAAAGCAGG + Intronic
976092807 4:81474503-81474525 ACTGTGATATCCAGGTAAACAGG + Intronic
979160053 4:117448405-117448427 ACAGAGGTCACCAGGGAAGTGGG + Intergenic
982281165 4:153684579-153684601 AATGTGGACACCAGCGAAGCCGG + Intergenic
982416638 4:155141098-155141120 ACTGAGGTTTCCATGGAAGTGGG - Intergenic
982981194 4:162137947-162137969 ACTATAGTCTCCTGGCAAGCTGG + Intronic
983645914 4:169991433-169991455 TCTGTGGCTTCCAGGTAAGCTGG + Exonic
983685828 4:170407655-170407677 ACTGTAGCCTCCTGGGAAGGTGG - Intergenic
983754675 4:171320164-171320186 ACACTGGTCTCCAGGGAAATGGG - Intergenic
985106270 4:186503154-186503176 TTAGTGGTCTCCAGGGAAACAGG + Intronic
985953542 5:3242617-3242639 AGTGTGGCTTCCAGGGAAGGTGG + Intergenic
986220966 5:5768179-5768201 ACTGAGGTGGCCAGGGAGGCAGG + Intergenic
986258984 5:6126145-6126167 ACAGAGGTCACCAGGGAAGTGGG - Intergenic
986709651 5:10479552-10479574 CCTCGGGTTTCCAGGGAAGCAGG - Intergenic
987100790 5:14589607-14589629 ACCCTGGCCTCCAGGGAAGGTGG - Intronic
987319006 5:16750179-16750201 ACTGGCGTCTCTCGGGAAGCAGG + Intronic
988923457 5:35964972-35964994 ACTGTGGTTTCGGGGTAAGCAGG - Intronic
990095670 5:52109220-52109242 ACTGTGGGCTGCAGAAAAGCAGG - Intergenic
990372072 5:55130464-55130486 ACTGTGGCCTCCATGGTATCTGG - Intronic
992578015 5:78139716-78139738 AGTGTGGTCTATGGGGAAGCAGG + Intronic
993229185 5:85210132-85210154 CCTGTGGTTTCCTGGGAAGGAGG + Intergenic
994087350 5:95773819-95773841 ACTGTGGTCACTCTGGAAGCAGG + Intronic
995717407 5:115093396-115093418 ACTGCGGTCCCCAGGCCAGCAGG - Intergenic
998108910 5:139486318-139486340 ATGGTGGGGTCCAGGGAAGCCGG + Intergenic
999183857 5:149690813-149690835 ACTGTGAGCTCCAGGGCAGTGGG + Intergenic
999308901 5:150538786-150538808 ACTGTGAGCTCCAAGGGAGCAGG - Intronic
999667787 5:153932029-153932051 ACTATTGTCTCCCGAGAAGCAGG - Intergenic
1001581057 5:172798825-172798847 ACAGTGGTCTCCACGGAAAGTGG + Intergenic
1002130675 5:177079728-177079750 TTGGTGGTCTCCAGGGAAGCGGG - Intronic
1002132965 5:177092576-177092598 ACTGTGGCCAACAGGGAAGCTGG - Intronic
1005107389 6:22238805-22238827 ACTGTGGTCGGCAGGTCAGCTGG + Intergenic
1005916510 6:30356793-30356815 ACTGTGGGTTCCTGGAAAGCAGG + Intergenic
1006463730 6:34178657-34178679 ACTGTGGGCACCAGGGAACATGG + Intergenic
1006799017 6:36747823-36747845 TCTGTGGTGTTCAGGGAGGCAGG - Intronic
1007574531 6:42916371-42916393 ACTGTGGGCTCCAGGGCAGGAGG - Intronic
1008428537 6:51387790-51387812 CCTGTGGTCTCCTTGGAAACAGG - Intergenic
1015213001 6:130719227-130719249 AATGTAGTCTCCATGAAAGCAGG + Intergenic
1015235539 6:130966749-130966771 CGTGTTGTCTCCAAGGAAGCTGG - Intronic
1015427075 6:133083301-133083323 AATGTGGCCTCCATGGAAGCAGG + Intergenic
1015612412 6:135038543-135038565 AGTGTGTTTTCCAGGGATGCTGG - Intronic
1017993313 6:159509150-159509172 ACTGAGATTTCCAGGGAAGGAGG - Intergenic
1018755256 6:166843071-166843093 ACTGTGGGCTGCATGGGAGCAGG + Intronic
1019485044 7:1285538-1285560 ACAGTGCTTTCCAGGGAGGCAGG + Intergenic
1019626036 7:2016126-2016148 CCTGTTGTTTCCAGGGCAGCTGG - Intronic
1019933230 7:4237352-4237374 ACTGAAGTCTCCAGGGCAGGGGG + Intronic
1020129700 7:5552842-5552864 TCTGTGGGTTCCAGGGAAGGAGG + Intronic
1020140775 7:5610530-5610552 TCAGGGGTCTTCAGGGAAGCCGG - Intergenic
1021716229 7:23465444-23465466 ACTGAGGTCTCAAGGGAATGTGG - Intronic
1022882892 7:34607270-34607292 ACTGTGGGCTCCTTGAAAGCAGG + Intergenic
1023843334 7:44108474-44108496 CCTGAGGGCTCCAGGGACGCAGG - Intronic
1023852137 7:44156530-44156552 TCTGTGGGCTGCAGGGAAGCAGG + Intronic
1024146647 7:46523589-46523611 AATGTGGTCTCTGGGCAAGCTGG - Intergenic
1024872998 7:53987609-53987631 TCTGTGGTTTCCTGGGAGGCCGG - Intergenic
1025093935 7:56083570-56083592 ACTGGGGTCTCAGGGGAGGCAGG - Intronic
1025100302 7:56129174-56129196 ACCCTGATCTCTAGGGAAGCAGG + Intergenic
1025624471 7:63207635-63207657 AGAGTGGTCCCCAGGGAAGAAGG + Intergenic
1026016993 7:66679421-66679443 ACTTTGGCCTCCAGAGTAGCTGG + Intronic
1026118086 7:67513208-67513230 ACTGTGGGCTTCCCGGAAGCAGG - Intergenic
1027200303 7:76060006-76060028 GCTGTGTGCTCCAAGGAAGCAGG - Intronic
1029359981 7:100081573-100081595 GCTGTGGTCGCCGGGGAAGGGGG - Intronic
1030195564 7:106849947-106849969 ACTGAGGTTTCCAGAGAAGAGGG + Intergenic
1030472417 7:109981952-109981974 AGTGTGGTCTCCAGGGTAGAAGG - Intergenic
1031240749 7:119236169-119236191 AATGTGGTATCCAAGAAAGCAGG + Intergenic
1034195104 7:149240171-149240193 CCTGGGGTCTCCCGGGCAGCGGG - Intronic
1034350348 7:150411155-150411177 TGTGTGGTCTCAGGGGAAGCTGG + Intronic
1034387521 7:150752972-150752994 ACGGTGGTCTCCACAGGAGCCGG + Intergenic
1034517373 7:151591328-151591350 ATTATGGTCTGCAGAGAAGCTGG + Intronic
1034754339 7:153600889-153600911 TCTGTGGGCTCCAGGCAGGCAGG + Intergenic
1035327319 7:158073496-158073518 GCTGTGTTCTGCAGGGCAGCTGG - Intronic
1035356991 7:158281890-158281912 ACTTTGGTCACCAGAGGAGCAGG + Intronic
1036490953 8:9225054-9225076 TCTGTGTTCCCCAGGGAAACAGG + Intergenic
1036767943 8:11560778-11560800 GATGTGGTCTCCAGGGCAGGGGG - Intronic
1037336524 8:17797612-17797634 ACTGTGGCCTCCTGAGAAGGAGG - Intronic
1037484066 8:19330992-19331014 AATGTGGCCTCCAGGTAAGGAGG - Intronic
1040690015 8:49925608-49925630 ACAGTGGTTTCCAGGGTAGCTGG - Intronic
1040701826 8:50075152-50075174 CCTGTGGGCTCCTGGGCAGCCGG + Intronic
1040796205 8:51292220-51292242 TCTGGGGTGTCCAAGGAAGCAGG + Intergenic
1041274504 8:56143133-56143155 ACTGTGGGCACCAGGGAACATGG - Intergenic
1041594002 8:59624564-59624586 AGTGGGGTGTCCAGAGAAGCAGG - Intergenic
1042217483 8:66440730-66440752 ACTGTGGTCCACAGAGCAGCAGG + Intronic
1043783015 8:84360861-84360883 ACTGTGTTCTTCAGGGAGTCAGG + Intronic
1044377379 8:91492196-91492218 ACTGTGGTCTCCTTAAAAGCAGG + Intergenic
1044806987 8:96018421-96018443 ACAGTGGGCTACAAGGAAGCAGG + Intergenic
1045610381 8:103834227-103834249 ACTGTCATCTCAAGGGAAACAGG - Intronic
1047180544 8:122583862-122583884 ACTGTGAGCTCCTGGGGAGCAGG - Intergenic
1047607367 8:126488531-126488553 ACTGTGAGCTACATGGAAGCTGG - Intergenic
1048279546 8:133094972-133094994 ACTGAGGACTCCAGGTGAGCAGG + Intronic
1049056047 8:140238432-140238454 CCTGAGAGCTCCAGGGAAGCAGG + Intronic
1051259797 9:15251969-15251991 ACTGAGAGCTCCAGGGGAGCAGG - Intronic
1051781041 9:20689325-20689347 ACTGTGGTACCCAGGGAGGAAGG + Intronic
1052006675 9:23357711-23357733 ACACTGGTCACCAGGGAAGTGGG + Intergenic
1053176324 9:35927388-35927410 AGTCTGGCCTGCAGGGAAGCAGG + Intergenic
1054791364 9:69259773-69259795 ACCTTAGTCTCCAGAGAAGCTGG - Intergenic
1055502153 9:76911846-76911868 GCTGTGAGCACCAGGGAAGCTGG - Intergenic
1056810202 9:89757949-89757971 AATGTGGTCTCCAGGGCTGGAGG + Intergenic
1057706402 9:97398169-97398191 ACTGTGGTCTCAACCGAGGCTGG - Intergenic
1058038810 9:100282291-100282313 ACTGTGGTCTACAGGCCAGCCGG - Intronic
1058781737 9:108343904-108343926 ACTGTGGACTACTGGGAAGGAGG + Intergenic
1059522269 9:114954386-114954408 ACTTTAGTCTGCAGGGAAGGTGG - Intergenic
1059913489 9:119073083-119073105 ACTATCATCTCCAAGGAAGCAGG - Intergenic
1060295832 9:122342469-122342491 ACTGTGGTCTCCAGGAATGCCGG + Intergenic
1060333782 9:122702442-122702464 ATGGTGGTTTCCAGGGAAGAGGG + Intergenic
1060383633 9:123201599-123201621 GCTGTGGTCTGCAGGGATACTGG + Intronic
1061118608 9:128629632-128629654 ACTGTGTTCTCTTGGGAAGGAGG + Intronic
1061852422 9:133423940-133423962 CCAGTGGTCTCTTGGGAAGCAGG - Intronic
1203438478 Un_GL000195v1:165736-165758 ACTGTGGTCTTAACTGAAGCTGG + Intergenic
1203465218 Un_GL000220v1:79761-79783 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1185659173 X:1713220-1713242 GCTTTGTCCTCCAGGGAAGCTGG + Intergenic
1186637092 X:11418162-11418184 AATATGGTCTCCAAAGAAGCAGG + Intronic
1187389330 X:18875580-18875602 TCTGTCGCCTCCTGGGAAGCTGG + Intergenic
1191223276 X:58014365-58014387 ACTGTGGGCTGCATGGGAGCAGG - Intergenic
1193196919 X:78643434-78643456 ACTGTGGGCTGCATGGGAGCTGG + Intergenic
1194538549 X:95141032-95141054 ACTGTGGTCCCCTAGGAAGAGGG - Intergenic
1195171481 X:102272812-102272834 AAGGTGCTCTCCAAGGAAGCTGG - Intergenic
1195187379 X:102414287-102414309 AAGGTGCTCTCCAAGGAAGCTGG + Intronic
1195273095 X:103252605-103252627 ACTGAGGACTCCAGGGAACTCGG + Intergenic
1195577241 X:106464991-106465013 CATGTGGTCTCCAGATAAGCTGG + Intergenic
1197083511 X:122446370-122446392 ATAGAGGTCTCCAGGGAAGTGGG - Intergenic
1199853616 X:151742272-151742294 ACTGTGAGCTCCAGGAAGGCAGG - Intronic
1199981612 X:152923815-152923837 TCTGTGGTCTGCTGGGAATCAGG - Intronic