ID: 1157570316

View in Genome Browser
Species Human (GRCh38)
Location 18:48708051-48708073
Sequence TTATATGGCCATAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157570316_1157570322 30 Left 1157570316 18:48708051-48708073 CCTTCCTCTTTATGGCCATATAA 0: 1
1: 0
2: 8
3: 58
4: 391
Right 1157570322 18:48708104-48708126 TTTATCCAGTCATCAGTGGACGG 0: 1
1: 25
2: 451
3: 2544
4: 6133
1157570316_1157570321 26 Left 1157570316 18:48708051-48708073 CCTTCCTCTTTATGGCCATATAA 0: 1
1: 0
2: 8
3: 58
4: 391
Right 1157570321 18:48708100-48708122 TTTATTTATCCAGTCATCAGTGG 0: 1
1: 2
2: 44
3: 187
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157570316 Original CRISPR TTATATGGCCATAAAGAGGA AGG (reversed) Intronic
900286503 1:1903415-1903437 TTATTCAGCCGTAAAGAGGAAGG - Intergenic
900896970 1:5490040-5490062 TTATGCAGCCATAAAGAAGAAGG + Intergenic
901162391 1:7188647-7188669 TTATTTAGCCTTAAAAAGGAAGG - Intronic
901321431 1:8342606-8342628 TTATGTGACCATAAAAGGGAAGG - Intronic
904097037 1:27987294-27987316 TTATTTGGCCTTAAAAAGGAAGG - Intronic
904597011 1:31653220-31653242 CTATATAGCCTGAAAGAGGATGG - Intronic
905587821 1:39135120-39135142 TTATTTAGCCTTAAAAAGGAAGG - Intronic
905836639 1:41129531-41129553 TTATTCAGCCTTAAAGAGGAAGG - Intronic
907188182 1:52627613-52627635 TTACTTAGCAATAAAGAGGAAGG + Intergenic
907701748 1:56795311-56795333 TTATTTAGCCTTAAAAAGGAAGG - Intronic
908724969 1:67165622-67165644 TTATGCAGCCATAAAAAGGAAGG + Intronic
910372238 1:86528525-86528547 TTATTCAGCCTTAAAGAGGAAGG - Intergenic
912632640 1:111259598-111259620 TTATATGGCAAGAAAGCAGAAGG + Intergenic
912644979 1:111383738-111383760 TGATATGGTCATAAAGAAGGAGG + Intergenic
913049642 1:115106030-115106052 TGATGTGGCAATACAGAGGAGGG + Intergenic
913154585 1:116082809-116082831 TTATGTAGCCTTAAAAAGGAAGG - Intergenic
914346736 1:146806523-146806545 TCACATGGCCTTAAACAGGAAGG + Intergenic
914919135 1:151835863-151835885 TTATAGGGACAGAAAGAGGGAGG - Intergenic
915045771 1:153013896-153013918 TCATTTGGCCTTAAAAAGGAAGG - Intergenic
916094113 1:161333172-161333194 TTATTCGGCCATAAAAAGGAAGG - Intronic
916685866 1:167145300-167145322 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
916722052 1:167491777-167491799 TTATTTGGCCTTGAAAAGGAAGG + Intronic
917519776 1:175738328-175738350 TTATTCAGCCATAAAAAGGAAGG + Intronic
918096454 1:181339484-181339506 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
918309139 1:183273167-183273189 TTTTATGGACAGAAAAAGGAAGG - Intronic
920410092 1:205752431-205752453 TTATTTGGCCTTTAAGAGAAAGG - Intergenic
921089433 1:211829941-211829963 TTATAATGCGAAAAAGAGGAAGG + Intronic
921333567 1:214064333-214064355 AAAAATGGCCAGAAAGAGGATGG + Intergenic
921343868 1:214161888-214161910 TTATATAGCCAGAAAGACTAGGG + Intergenic
921757375 1:218874531-218874553 TTATATGACGATCAGGAGGAAGG + Intergenic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
922865259 1:228855050-228855072 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
923754690 1:236780783-236780805 ATATAAGGACACAAAGAGGATGG + Intergenic
1063142237 10:3265521-3265543 TTATGCAGCCTTAAAGAGGAAGG + Intergenic
1064023260 10:11826209-11826231 TTATTCGGCGATAAAAAGGAGGG - Intronic
1064260387 10:13780997-13781019 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1065241032 10:23704639-23704661 TTATTTGGCAATAAAAAGAAAGG - Intronic
1065633426 10:27706211-27706233 TTATTCAGCCTTAAAGAGGAAGG - Intronic
1065827011 10:29581872-29581894 TTATTCGGCCTTAAAAAGGAAGG + Intronic
1066065268 10:31757128-31757150 TTTTTTGGCAAAAAAGAGGATGG - Intergenic
1066123285 10:32312530-32312552 CTATATGGCCTTTCAGAGGATGG - Intronic
1066397128 10:35036979-35037001 TTAAAAGGCCATTAAGAGGGAGG - Intronic
1066569580 10:36756370-36756392 TTATATAGACAGAAACAGGAGGG + Intergenic
1067856890 10:49802156-49802178 TTATATAGCTTTAAAAAGGAAGG - Intergenic
1069350230 10:67516934-67516956 TTATTTAGCCTTAAAAAGGAAGG - Intronic
1069525984 10:69171946-69171968 TAATATGGCCAAAAAAAAGAAGG - Exonic
1070697650 10:78574735-78574757 ATGTATGGCCCTAAAGAGAATGG + Intergenic
1070995258 10:80773199-80773221 TTATTCAGCCATAAAAAGGAAGG - Intergenic
1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG + Intronic
1072519391 10:96217149-96217171 TTATTTGGCCATAAAAAGACGGG - Intronic
1072845787 10:98828994-98829016 TTATTTGGCCTTAAAAAGGAAGG + Intronic
1073349163 10:102807362-102807384 ATATATGGACAGAAAAAGGAGGG - Intronic
1073738072 10:106372645-106372667 TTATTCAGCCTTAAAGAGGAAGG - Intergenic
1074926385 10:118076532-118076554 TTCAATGGCCTTAAAAAGGAAGG - Intergenic
1075161073 10:120024991-120025013 TTTTATGGCCATGAAGAAGAAGG + Intergenic
1075583642 10:123641969-123641991 TTACTTGGCAATAAAAAGGAAGG + Intergenic
1075609583 10:123841685-123841707 TTATTCAGCCTTAAAGAGGAAGG - Intronic
1075730648 10:124634211-124634233 TTATTTGGCCATAAAAAGAAAGG + Intronic
1078285336 11:9948094-9948116 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1078667065 11:13334596-13334618 TTTTATGGCCAGAAAGTAGAAGG + Intronic
1078689912 11:13569402-13569424 TTATTTAGCCTTAAAGAGGATGG + Intergenic
1080009067 11:27439400-27439422 TTATTTAGCCTTAAAAAGGAAGG - Intronic
1080495900 11:32818715-32818737 TTATTTAGCCATAAAAAGGAGGG + Intergenic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1081687190 11:45051293-45051315 TTATTTAGCCTTAAAGAGGAAGG - Intergenic
1081827737 11:46073744-46073766 TTATATAGCCATTAAGATCATGG - Intronic
1083369722 11:62168727-62168749 TTATCTAGCCTTAAAAAGGAAGG - Intergenic
1083817294 11:65141951-65141973 TTATTTAGCCATAAACAGGAAGG + Intergenic
1084137455 11:67196534-67196556 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1084627084 11:70316378-70316400 TTATTCAGCCATAAAAAGGAAGG - Intronic
1084716081 11:70874494-70874516 TAATTTTGCCATACAGAGGAAGG - Intronic
1084914004 11:72414187-72414209 ATACAAGGCCATAAACAGGAGGG + Intronic
1084942788 11:72622500-72622522 TTATGTGGCCATAAAAAGGAAGG + Intronic
1085059535 11:73432108-73432130 TTATTCAGCCATAAAGAAGAAGG - Intronic
1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG + Intergenic
1087173660 11:95076231-95076253 TTATTTGGCAATAAAAAGAAAGG - Intergenic
1087183036 11:95158258-95158280 GTATATGGGCATAGAGAGCAAGG + Intergenic
1089064434 11:115651789-115651811 TTATTCAGCCTTAAAGAGGAAGG - Intergenic
1089776583 11:120841438-120841460 TTATTTGGCCTTAAAAAGGCAGG - Intronic
1093855488 12:24096633-24096655 TTATTCAGCCATAAAGAGAAGGG - Intergenic
1094405445 12:30111061-30111083 GTTTATAGCCATAGAGAGGATGG - Intergenic
1094430915 12:30368290-30368312 ATATGTAGCCATAAAAAGGAAGG - Intergenic
1095135689 12:38599888-38599910 TTATACAGCCTTAAAAAGGAAGG + Intergenic
1095748282 12:45683515-45683537 TTATTTGGCCTTAAAAGGGAAGG + Intergenic
1096168182 12:49443080-49443102 TTATTCGGCCTTAAAGAGGAAGG - Intronic
1098362498 12:69668343-69668365 TTATATGGTCACCAAGAGGCAGG + Intronic
1098937875 12:76501354-76501376 TTAAAGGGCTATAAAGAAGAAGG + Intronic
1099659027 12:85532033-85532055 TTAATTGTCCATAAAGAAGATGG + Intergenic
1100152193 12:91752265-91752287 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
1100634956 12:96426723-96426745 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
1100864949 12:98847441-98847463 TTATTTGGCCATGAAAAAGAAGG - Intronic
1101012110 12:100461412-100461434 TTATACAGCCATAAAGAAGATGG - Intergenic
1101284131 12:103292076-103292098 TTATTTGGCCATTAAAAAGAAGG + Intronic
1101675186 12:106910756-106910778 TATGGTGGCCATAAAGAGGATGG + Intergenic
1101762958 12:107674069-107674091 TTATAAGGGCAAAAAGAGGTCGG + Intergenic
1102181557 12:110916480-110916502 TTATTCAGCCATAAAAAGGAGGG + Intronic
1102307125 12:111813620-111813642 TTATTTAGCCATAAAAAGGAAGG + Intergenic
1103837502 12:123834856-123834878 TTATTGGGCCATAAAAAGGACGG - Intronic
1104406615 12:128523065-128523087 TTATTCAGCCATAAAAAGGAAGG + Intronic
1104423079 12:128653084-128653106 TTATCAGGCCATTAAAAGGAAGG + Intronic
1106346466 13:28884212-28884234 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1106537563 13:30660669-30660691 TTATCTCTCCATACAGAGGAGGG + Intronic
1107193933 13:37624145-37624167 TTACTTGGACATAAAGAGAAAGG + Intergenic
1107598697 13:41990701-41990723 TTTTATGGAAATAAAGAGGAGGG - Intergenic
1108430140 13:50345163-50345185 TCATTTGGCCTTAAAGTGGATGG - Intronic
1110274883 13:73632317-73632339 ATATAGGCACATAAAGAGGAAGG - Intergenic
1110896764 13:80762554-80762576 TTATGTGGCCATGAAGTAGATGG - Intergenic
1110907245 13:80907123-80907145 TTCCATGGCAAAAAAGAGGAAGG + Intergenic
1111116366 13:83783250-83783272 TGATATAGCAATAATGAGGATGG + Intergenic
1112498481 13:99924081-99924103 TTATACAGCCTTAAAAAGGAAGG + Intergenic
1113136934 13:107101188-107101210 TAATATGGCCACATGGAGGAGGG - Intergenic
1113187260 13:107702877-107702899 CTATACAGCCATAAAAAGGAAGG - Intronic
1113491476 13:110695553-110695575 TTATTCAGCCATAAAAAGGAAGG + Intronic
1115269235 14:31533379-31533401 TTAACTGGCCATAAAAATGAAGG + Intronic
1115796758 14:36945521-36945543 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1116853722 14:49933340-49933362 TTATACAGCCTTAAAAAGGAAGG - Intergenic
1117825717 14:59701478-59701500 CTATTTTGCCATAAAAAGGAAGG + Intronic
1118561250 14:67086041-67086063 TTATTTAGCCTTAAAAAGGAAGG - Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118723824 14:68612784-68612806 ATATTTGACCATAAAAAGGAAGG + Intronic
1119211387 14:72834855-72834877 TTATTCAGCCATAAAAAGGAAGG + Intronic
1119843685 14:77812463-77812485 TTATCCAGCCATAAAAAGGAAGG - Intronic
1120899500 14:89563618-89563640 TTAGATGGGCAGAAAGGGGAGGG + Intronic
1122432245 14:101660495-101660517 TTATTTGGCTTTAAAAAGGAAGG - Intergenic
1123046594 14:105520483-105520505 TTATTTGGCAATAAAAAGGAAGG + Intergenic
1124134660 15:27023642-27023664 TTATTTTGCCTTAAAGAGGAAGG - Intronic
1124198085 15:27650765-27650787 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
1125090617 15:35787376-35787398 CTATTTGGCCATAAAAAAGAAGG - Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1129113984 15:73354802-73354824 TTCTATGGCCATTAAGATGCAGG + Intronic
1129924549 15:79351535-79351557 TATTATGGCCATAAAAAGGTGGG - Intronic
1130801085 15:87264023-87264045 TTATATGGCCTGAAAGGGGAAGG + Intergenic
1131920402 15:97321165-97321187 TTATACAGCCATAAAAAAGAAGG + Intergenic
1132060202 15:98686216-98686238 TTATTGGGCCTTAAAAAGGAAGG - Intronic
1133398656 16:5468692-5468714 TTATACAGCCATAAAAAGGAAGG + Intergenic
1133971416 16:10570876-10570898 TTAGCTGGACAGAAAGAGGAAGG + Intronic
1136094351 16:27944313-27944335 TTATTTTGCAATAAAAAGGAAGG + Intronic
1138345734 16:56319127-56319149 TTACATTGCCATGAAGAGAAGGG + Intronic
1139460212 16:67116044-67116066 TTAGATGTCAAGAAAGAGGAAGG - Intronic
1139987245 16:70908747-70908769 TCACATGGCCTTAAACAGGAAGG - Exonic
1140787501 16:78356972-78356994 ATACATGGCCATAAAAAGGTAGG - Intronic
1141135847 16:81464890-81464912 TTATTTGGCCTTAAAAAGGAAGG - Intronic
1141883573 16:86876010-86876032 TTATTTGGCCATAAAAAGGAGGG + Intergenic
1142191141 16:88718490-88718512 TCATTTGCCCATAAACAGGAAGG + Intronic
1143745127 17:8987896-8987918 TTATTTAGCAATAAAAAGGATGG - Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144599908 17:16602470-16602492 TTATTTGGCTTTAAAAAGGAAGG - Intergenic
1144686492 17:17229354-17229376 TCACATGGCCTTAAAAAGGAAGG + Intronic
1144999649 17:19294967-19294989 TTATATGACTAGAAACAGGAGGG + Intronic
1150955180 17:69850441-69850463 TTATTTGGCCTTAAAAAGAAAGG - Intergenic
1152086534 17:78222936-78222958 TTAACTGGACATGAAGAGGAAGG + Intronic
1152385545 17:79972148-79972170 TTATTTAGCTATAAAAAGGAAGG + Intronic
1154059187 18:11042992-11043014 TTGTTTGGCCATAGAAAGGAGGG + Intronic
1156604763 18:38653362-38653384 TTATCTGGCCATAAAAAGGAAGG + Intergenic
1156641753 18:39109345-39109367 CTATATGGCCATGAAGATCATGG + Intergenic
1157105063 18:44766356-44766378 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1157500525 18:48187364-48187386 TTATTTAGCCTTAAAGTGGAAGG + Intronic
1157570316 18:48708051-48708073 TTATATGGCCATAAAGAGGAAGG - Intronic
1158438948 18:57456395-57456417 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1159416833 18:68162022-68162044 ATATATGTAAATAAAGAGGAAGG + Intergenic
1159760216 18:72416612-72416634 TTATGCAGCCATAAAAAGGAAGG + Intergenic
1161928051 19:7316152-7316174 TTATTTAGCCATTAAAAGGAAGG + Intergenic
1162277689 19:9670489-9670511 TTATTCAGCCATAAAGAGAATGG + Intronic
1162504355 19:11074255-11074277 TTATTTGGCCTTTAAAAGGAAGG + Intergenic
1163119308 19:15207285-15207307 TTACTTAGCCATAAAAAGGAAGG - Intergenic
1163345226 19:16737042-16737064 TTCTATAGACATAAAGTGGAGGG - Intronic
1163348641 19:16761196-16761218 TTATGTAGCCATGAAAAGGAAGG - Intronic
1164239064 19:23367726-23367748 TTATTTGGCCATATACAGAAGGG - Intronic
1168361082 19:55741289-55741311 TTATACAGCCTTAAAAAGGAAGG + Intergenic
925063055 2:908168-908190 TTTTAGGGCCCTAGAGAGGATGG - Intergenic
925075806 2:1014729-1014751 TTATATGGGCAGAGAGAGAAGGG + Intronic
925268316 2:2582996-2583018 TCATTTTGCCAGAAAGAGGAAGG + Intergenic
926017434 2:9466840-9466862 TTATTTGGCCATAAAAAGGAAGG - Intronic
926832850 2:16982434-16982456 TTATATGGCCACAAAAAGGAAGG - Intergenic
926940282 2:18128661-18128683 TTATACAGCCATAAAAAGAATGG + Intronic
927005653 2:18845449-18845471 TCATATGGGCAGAAAGTGGAGGG - Intergenic
927361483 2:22239722-22239744 TAATATGGCCATAACAAAGAAGG + Intergenic
927749459 2:25654184-25654206 TTATATTGCTTTAAAGTGGAAGG - Intronic
929343924 2:40857420-40857442 TTATTTGGCAATAAAAAGGAAGG + Intergenic
929661067 2:43785342-43785364 TAATTTGGCCTTAAAAAGGAAGG + Intronic
930747481 2:54899878-54899900 TTATATGCCCATAAATATGCTGG + Intronic
931688576 2:64815959-64815981 TTTTATGGCCATGAAGAAGATGG + Intergenic
931740741 2:65240516-65240538 GTATCTTACCATAAAGAGGAAGG + Intronic
933405346 2:81851125-81851147 TTATTCAGCCTTAAAGAGGAAGG + Intergenic
934547118 2:95227055-95227077 TGATATGGCCCTAGAAAGGAGGG + Intronic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
936159288 2:110071703-110071725 TTATAGGGCCCTGGAGAGGAAGG + Intergenic
936185373 2:110299629-110299651 TTATAGGGCCCTGGAGAGGAAGG - Intergenic
936386794 2:112037695-112037717 TTATTCAGCCTTAAAGAGGAAGG + Intergenic
936735549 2:115438552-115438574 TTATTTAGCCTTAAAGAGGAAGG + Intronic
936749766 2:115627859-115627881 TTATACAGCCATAAAAAGGAAGG - Intronic
937510057 2:122585327-122585349 TTATTTAGCCATAAAAATGAAGG + Intergenic
937760138 2:125590989-125591011 CTATACAGCCATAAAAAGGAAGG + Intergenic
937999848 2:127724166-127724188 TTATATTGCAATAAAGAGATTGG - Intronic
938753016 2:134352861-134352883 TTATTTAGCCTTAAAAAGGAAGG + Intronic
938844351 2:135193673-135193695 TTATTTGGCCTAAAATAGGAAGG + Intronic
939172899 2:138716261-138716283 TTATATCCCCATAAAATGGATGG + Intronic
940216016 2:151304327-151304349 TTATTTGGCCTTAAAAAGGAAGG + Intergenic
940287325 2:152045331-152045353 TTATCTAGCCTTAAAAAGGAAGG + Intronic
940772940 2:157858214-157858236 TCCTATCGCCATAGAGAGGAAGG - Intronic
941966524 2:171305948-171305970 TTATTCAGCCTTAAAGAGGAAGG - Intergenic
942524878 2:176842393-176842415 TTGTAGGGCAATAAAGAAGACGG - Intergenic
942818075 2:180076145-180076167 TTATATGCCTATAAAGAGTGTGG - Intergenic
943400285 2:187400686-187400708 TTATTTGGCAATAAAGAGGAAGG + Intronic
944661072 2:201922271-201922293 TTATTTAGCCATGAAAAGGAAGG - Intergenic
945111477 2:206364492-206364514 TTATATGGCCATGGAGAAGATGG - Intergenic
945457542 2:210066744-210066766 TTATACAGCAATAAAAAGGATGG - Intronic
945843956 2:214920830-214920852 CTATTTAGCCTTAAAGAGGAAGG + Intergenic
947092083 2:226523359-226523381 TTATTTAGCCATAAAAAGGAAGG + Intergenic
947769737 2:232661479-232661501 TTATTTGGCAATAAAAAGGAAGG - Intronic
948331745 2:237173069-237173091 TTATTTAGCCTTAAAGAGGAGGG - Intergenic
948422582 2:237869596-237869618 TTATTTGGCCTTCAAAAGGAAGG - Intronic
948510717 2:238462635-238462657 CTATTTGGCCATGAAAAGGAAGG - Intergenic
948539876 2:238683239-238683261 TTATATGACCATAGATGGGATGG - Intergenic
948706548 2:239796649-239796671 TTATTTAGCCTTAAAGAGGAAGG - Intronic
948937309 2:241175510-241175532 TTATTTGGCCCTAAAAAGAAAGG - Intronic
1168831955 20:850526-850548 TCATACAGCCAGAAAGAGGAAGG - Intronic
1169014795 20:2282764-2282786 TAATATTGCCCTAAAGTGGAAGG - Intergenic
1170443375 20:16400669-16400691 TTATTTGGCCACAAAAAGAAAGG + Intronic
1170638467 20:18130071-18130093 TTATTAAGCCTTAAAGAGGAAGG + Intergenic
1170652320 20:18253995-18254017 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
1172548256 20:35778838-35778860 TTATTTGGCAAAAGAGAGGAAGG - Intronic
1172605231 20:36209474-36209496 TTATCTGGCCATAGAGAGCAGGG + Exonic
1173388070 20:42607006-42607028 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1173698355 20:45043185-45043207 TTATGCAGCCATAAAAAGGAAGG - Intronic
1174625355 20:51909720-51909742 TTGAATGGCCAAAAAAAGGAGGG + Intergenic
1175175789 20:57111166-57111188 TTATACAGCCTTAAAAAGGAAGG - Intergenic
1176010291 20:62889871-62889893 TTATATGTCCATAAAGGGATTGG - Intronic
1176361866 21:6003946-6003968 ATTTATGGCCATAAAGAGTGTGG - Intergenic
1178088073 21:29132983-29133005 TTATATGACCTTAAAGAGGCAGG + Intronic
1179483450 21:41693405-41693427 TTTTATGGCCCTGAAGAAGATGG - Intergenic
1179761652 21:43534599-43534621 ATTTATGGCCATAAAGAGTGTGG + Intronic
1180963672 22:19774626-19774648 TTATCCAGCCTTAAAGAGGAAGG + Intronic
1182208561 22:28653550-28653572 TTATATGGCCCTGGAGAAGATGG + Intronic
1182529912 22:30947278-30947300 TAATGTGGCCAAACAGAGGAAGG - Intronic
1183578489 22:38707468-38707490 CTGTAAGGCCATAATGAGGATGG + Intronic
1184188752 22:42881158-42881180 TTTTATGGCCCTTAACAGGAAGG - Intronic
1184372525 22:44091654-44091676 TTATCTAGCCCTAAAAAGGAAGG - Intronic
949300805 3:2581807-2581829 TTATTCAGCCATAAAAAGGAAGG + Intronic
950641066 3:14348584-14348606 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
950719683 3:14874094-14874116 TTATTCAGCCATAAAAAGGAAGG + Intronic
950905379 3:16533095-16533117 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
951095690 3:18627249-18627271 TTATTTAGCCTTAAAAAGGAGGG + Intergenic
951284824 3:20797315-20797337 AAATATGGCCATAATGAGAAAGG - Intergenic
951768308 3:26225360-26225382 TCACAGTGCCATAAAGAGGAAGG + Intergenic
952731463 3:36641087-36641109 TTATTTGGCCATGAAAAGGATGG - Intergenic
953281803 3:41565413-41565435 TTATAATGGCATTAAGAGGATGG + Intronic
953408711 3:42675363-42675385 TTATTCAGCCTTAAAGAGGACGG - Intergenic
953820280 3:46202451-46202473 TAAAATAGCCATAAAGGGGAGGG - Exonic
954049811 3:47965229-47965251 TTATTTAGCCTTAAAAAGGAAGG - Intronic
954730339 3:52655406-52655428 TTATTTGGCGTTAAAAAGGAAGG - Intronic
955226071 3:57061470-57061492 TTATTTAGCCTTAAAAAGGAAGG - Intronic
955421097 3:58738520-58738542 CTATGTAGCCATAAAAAGGAAGG - Intronic
955445488 3:59005980-59006002 TAATTTGGGCATATAGAGGAAGG + Intronic
955915295 3:63901801-63901823 TTATTTAGCCATAAAAAAGAAGG + Intronic
955950882 3:64240880-64240902 TTTTATGGCCAAGAAGAGGAAGG + Intronic
957336679 3:78838822-78838844 AGATATGGCCAAAAAGAGAAGGG + Intronic
957442448 3:80267163-80267185 TTATTTGACCATAAAAAGAAAGG + Intergenic
957518404 3:81286578-81286600 CTATATGGTCTAAAAGAGGAAGG + Intergenic
959084042 3:101832644-101832666 TTATTCGGCCTTAAAAAGGAAGG - Intronic
959260398 3:104072102-104072124 CTATACAGCCATAAAAAGGAAGG + Intergenic
959407061 3:105972901-105972923 ATATATGGATATAAAAAGGATGG - Intergenic
959654234 3:108782915-108782937 TTATTTGGCCTTAAAAAAGAAGG - Intergenic
959710600 3:109382217-109382239 TTTCATGGCCATGAAGAAGATGG + Intergenic
960021609 3:112962079-112962101 TTATATTGCCTTAAAAAGTAGGG - Intronic
960074670 3:113471198-113471220 TTATATGGCAAAAAAGGGGTAGG + Intronic
960704614 3:120469948-120469970 TTATATGGCCTAAAAAGGGAAGG + Intergenic
960956054 3:123031897-123031919 TTAGATGGTCATGCAGAGGAGGG - Intergenic
961778774 3:129309013-129309035 TTATTTGGCCTTAAAAAGGAAGG - Intergenic
962449349 3:135499106-135499128 ATATAAGGGCAGAAAGAGGATGG + Intergenic
962479329 3:135785317-135785339 TGATAGGACCATAAAGATGAAGG - Intergenic
962659860 3:137590503-137590525 TTATTTGGCCTTAAAAAAGAAGG - Intergenic
963171014 3:142251371-142251393 TTATTTGGCCATAAAAAAGGAGG + Intergenic
963878494 3:150502687-150502709 TTATTTAGCCATAAAAAGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966366515 3:179193973-179193995 TTAAATACCAATAAAGAGGATGG - Intronic
967039990 3:185683101-185683123 TTATTTGGCCATAAAAAGGAAGG + Intronic
968208023 3:196821936-196821958 TTATTTGGTCATAGAAAGGAAGG + Intronic
968227818 3:196986570-196986592 TTATACAGCCTTAAAAAGGAAGG + Intergenic
968792388 4:2675969-2675991 TTATTTAGCCTTAAAAAGGAAGG - Intronic
969340888 4:6540407-6540429 TTATACAGCCCTAAAAAGGAAGG - Intronic
969355392 4:6622105-6622127 TTATTTGGCCATAAAAAGGAAGG + Exonic
969406654 4:6997679-6997701 TTATTTGGCCTTAAAAAGGAAGG + Intronic
970033754 4:11707995-11708017 CTATACAGCCATAAAAAGGAAGG - Intergenic
971024643 4:22576662-22576684 TTATTTGGCCTTAAAAAGGAAGG + Intergenic
971247996 4:24947875-24947897 TTATTTGGCCATATTGCGGATGG - Intronic
971675823 4:29627955-29627977 TTATGCAGCCATAAAAAGGAAGG - Intergenic
971727630 4:30334043-30334065 TAAAATGGCCCTAAAGAGTAGGG + Intergenic
972042330 4:34618857-34618879 TTCTATGGCACTAAAGCGGAGGG + Intergenic
972193307 4:36621425-36621447 TTAAATGCCCATAAACAGAATGG + Intergenic
974753558 4:66172996-66173018 TTATTCAGCCATAAAAAGGAAGG - Intergenic
975826004 4:78320216-78320238 TTAAATGGCCACAGAGAGGTTGG - Intronic
977650768 4:99466651-99466673 TTTTCTGGGCATAAAGAGGACGG - Intergenic
977749989 4:100597984-100598006 TTATTTATCCTTAAAGAGGAGGG - Intronic
978045953 4:104127811-104127833 TTATATGAAAAAAAAGAGGAAGG + Intergenic
978212937 4:106159966-106159988 TTATTTGACCATATATAGGAGGG - Intronic
978477865 4:109152675-109152697 TAATTTGGCCTTAAAAAGGAAGG + Intronic
978539178 4:109797991-109798013 TTATTTGGCCTTAAAAAAGAAGG + Intronic
979948010 4:126859037-126859059 TTATTTGGCCCTAGAAAGGAAGG + Intergenic
980034650 4:127869872-127869894 TTATTTGGCCTTAAAAAAGAAGG - Intergenic
980514512 4:133837512-133837534 TTATTTAGCCATAAAAAGTAAGG - Intergenic
981611010 4:146593725-146593747 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
982163889 4:152597207-152597229 TTATTCGGCCTTAAAAAGGAAGG - Intergenic
984519030 4:180778312-180778334 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
985393935 4:189521339-189521361 TTTTATGGCCATGAAGAAGATGG + Intergenic
985709751 5:1421685-1421707 TCATATGGCCATAATCAGGTTGG - Intronic
987016501 5:13825517-13825539 TTATTTAGCCATAAAAAGAAAGG + Intronic
987718185 5:21598249-21598271 TCATATGGCCAGAAGGAGCAAGG + Intergenic
988017444 5:25577499-25577521 TTATATAGCAGTCAAGAGGAAGG - Intergenic
988224354 5:28392804-28392826 TCATATGGCAAAAGAGAGGAAGG - Intergenic
988711377 5:33779628-33779650 TTATTTGGCCTTTAAAAGGAAGG + Intronic
988737145 5:34033793-34033815 TTATATAGTCATAAAAAAGAAGG + Intronic
989004087 5:36790319-36790341 TTATACAGCCTTAAAAAGGAAGG - Intergenic
992552563 5:77872975-77872997 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
992918637 5:81487989-81488011 TTATTTGGCCATAAACAAGAAGG - Intronic
993418610 5:87670174-87670196 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
994895131 5:105693372-105693394 TTTTATGGCCATGAAGAAGATGG + Intergenic
995609343 5:113892272-113892294 TTAGAAGGCCATTAAGAGGGAGG - Intergenic
996120105 5:119662073-119662095 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
996938838 5:128979368-128979390 TTCTCTGGCCAAAAAGAAGAAGG + Intronic
998191803 5:140031651-140031673 TTGTATGGCTTTAGAGAGGAGGG - Intronic
998332025 5:141337430-141337452 TTATTTAGCCTTAAAAAGGAAGG + Intronic
999661322 5:153866206-153866228 TTCAATGGACATAAAGGGGAGGG + Intergenic
1000029785 5:157391613-157391635 TTATACAGCCATAAAAAGGATGG - Intronic
1000959628 5:167584569-167584591 TTATCTGGGCATGAAGAGGTGGG + Intronic
1001279526 5:170376702-170376724 TTATGCAGCCATAAAAAGGAAGG - Exonic
1001384242 5:171325142-171325164 TTACTCAGCCATAAAGAGGAAGG + Intergenic
1001635103 5:173204349-173204371 TTATTCAGCCATAAAAAGGAAGG - Intergenic
1001752019 5:174138600-174138622 TTATGTAGCCATAAAAAGGAAGG - Intronic
1001858109 5:175030398-175030420 TTATTCGGCCATAAAAAGAATGG - Intergenic
1002770299 6:284746-284768 TTATTTGTACCTAAAGAGGATGG + Intergenic
1003259214 6:4501487-4501509 TTATTTGGCCGTAAAAAGGAAGG - Intergenic
1003712435 6:8607515-8607537 TTATACAGCCTTAAAAAGGAAGG + Intergenic
1004539154 6:16533034-16533056 TTATTCAGCCCTAAAGAGGAAGG + Intronic
1004684253 6:17927324-17927346 TTATTCAGCCATAAATAGGAAGG + Intronic
1005107914 6:22245601-22245623 TTATTTAGCCTTAAAAAGGAGGG - Intergenic
1005351081 6:24936215-24936237 TCATATTTCCTTAAAGAGGAAGG + Intronic
1005657986 6:27963233-27963255 TTATTTGGCAATAAAAAAGAAGG - Intergenic
1005866061 6:29938147-29938169 TTATGCAGCCATAAAAAGGAAGG + Intergenic
1006791847 6:36706691-36706713 TTATATTGCCATAGAAAGTAAGG + Intronic
1006827999 6:36950375-36950397 TTATTTTGCCTTAAAAAGGAAGG - Intronic
1006861913 6:37177412-37177434 CCATGTGGCTATAAAGAGGAAGG + Intergenic
1008494741 6:52121667-52121689 TAATATGGGGATAAAGAGGAGGG - Intergenic
1009324411 6:62332101-62332123 TTATTTGACCATAAAAAGAAAGG - Intergenic
1010227566 6:73505313-73505335 TTATACAGCCTTAAAAAGGAAGG + Intronic
1011155883 6:84330977-84330999 CTATATAGCCTTAAAGAGGAGGG + Intergenic
1011490354 6:87885171-87885193 TTATCTGTCCATAAAGATAATGG + Intergenic
1011570823 6:88732661-88732683 TTATTTGGCCTTAAAAAGGAAGG + Intronic
1011849380 6:91606623-91606645 TTATATTCCAACAAAGAGGAGGG - Intergenic
1011911563 6:92447311-92447333 TTATGCAGCCATAAAAAGGATGG + Intergenic
1012556894 6:100524557-100524579 TTAAATGTACATAAAGAGGTAGG + Intronic
1013451298 6:110284020-110284042 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1013795224 6:113880539-113880561 CTATATGGCCATAAAAAAGAAGG - Intergenic
1013932717 6:115554045-115554067 TTATTTTCCCATCAAGAGGAGGG + Intergenic
1014685913 6:124500091-124500113 TAATATGCCAATAATGAGGAGGG - Intronic
1015216649 6:130758003-130758025 GTTTATGGCCATGAAGAAGATGG + Intergenic
1015637898 6:135297076-135297098 TGCTACTGCCATAAAGAGGAAGG - Intronic
1017026333 6:150184547-150184569 ACATGTGGCCATGAAGAGGATGG - Intronic
1017193432 6:151677021-151677043 ATATATATCCATAAAGATGAGGG + Intronic
1018034339 6:159868443-159868465 TTATTCAGCCATAAAAAGGAAGG + Intergenic
1019568875 7:1699120-1699142 CTATACGGCAATGAAGAGGAAGG - Intronic
1021174708 7:17437809-17437831 TTTGATGTCCATTAAGAGGAAGG - Intergenic
1021465852 7:20942895-20942917 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
1022141864 7:27499806-27499828 TTATATGGCCAGAGAGAGAGGGG + Intergenic
1022252790 7:28625483-28625505 TTATATAGTCAAAAAGAAGAGGG + Intronic
1023042868 7:36187580-36187602 TTATCAGGCCTTAAAAAGGAAGG - Intronic
1023740466 7:43276563-43276585 TTATAATGACATAAAGATGATGG - Intronic
1024567807 7:50696970-50696992 TTATTTGGCCTTCAAAAGGAAGG + Intronic
1024743402 7:52379806-52379828 TTATTCAGCCATAAAAAGGATGG + Intergenic
1024979842 7:55147963-55147985 TTATTCAGCCATGAAGAGGAAGG - Intronic
1025034533 7:55585460-55585482 TTTCATGGCCATGAAGAAGAGGG + Intergenic
1026397863 7:69976332-69976354 TTATATAGCCTTAGAAAGGAAGG - Intronic
1026971282 7:74469610-74469632 TTATTTGGCCATAAAAAGAAAGG - Intronic
1028410192 7:90522324-90522346 ATATATGGCCATATGGAGAACGG - Intronic
1028612756 7:92730714-92730736 TTATTTAACCTTAAAGAGGAAGG - Intronic
1028703490 7:93811531-93811553 TGATATGTGCATAAAGAGGGAGG - Intronic
1028948611 7:96608754-96608776 TTATTCTGTCATAAAGAGGAGGG - Intronic
1029148119 7:98461080-98461102 TGATTTGGCCTTAAAAAGGAAGG - Intergenic
1029470524 7:100751642-100751664 TTAGATGGCAGTAAAGAGGGTGG + Intronic
1029706000 7:102276028-102276050 TTATACAGCCTTAAAAAGGAAGG - Intronic
1030097977 7:105918077-105918099 TTATTTAGCCTTAAAAAGGAAGG - Intronic
1032803265 7:135333494-135333516 TTCTTTGTCCATAAAGAGGTAGG + Intergenic
1035558934 8:590541-590563 TTATTTAGCCACAAAAAGGAAGG + Intergenic
1036456310 8:8911568-8911590 TTATTCAGCCATAAAAAGGAGGG + Intergenic
1036710599 8:11076029-11076051 TTATTCAGCCATAAAAAGGAAGG + Intronic
1037928086 8:22860562-22860584 TTATTCAGCCTTAAAGAGGAAGG - Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038233011 8:25722554-25722576 TTATATAGACATTAAAAGGAAGG - Intergenic
1038320204 8:26518781-26518803 TTATTCAGCCATAAAAAGGAAGG - Intronic
1038320509 8:26521859-26521881 TTATTTGGCCCTAAAAAGGAAGG - Intronic
1039351651 8:36770133-36770155 CCATGTGGCCAGAAAGAGGAAGG + Intergenic
1041104955 8:54432851-54432873 TTATTTGGCCTTAAAAAGGAAGG + Intergenic
1041232992 8:55772468-55772490 TCATGTGGGCATAAATAGGATGG - Intronic
1041912741 8:63106264-63106286 TGAAAGGGCCATAAAGAAGATGG - Intergenic
1042811037 8:72825227-72825249 TTATTTAGCCTTAAAAAGGAAGG - Intronic
1043362261 8:79488104-79488126 TTTTATGGCTTTAAATAGGAAGG + Intergenic
1045352823 8:101358086-101358108 TTATTTGGCCTTAAAAAGGAAGG - Intergenic
1045576091 8:103421801-103421823 TTATTTAGCCATAAAAAGAAAGG - Intronic
1046675636 8:117104880-117104902 CTATATGGCCGAAAAGGGGAAGG - Intronic
1046720242 8:117611003-117611025 ATATATGGACAGAAAAAGGAAGG + Intergenic
1047221326 8:122921028-122921050 TTATAGGGCCATTGTGAGGATGG + Intronic
1047648794 8:126897862-126897884 TTATACAGCCTTAAAAAGGAAGG - Intergenic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1047883262 8:129219681-129219703 TTATTTAACCATAAAAAGGAAGG + Intergenic
1048171230 8:132108773-132108795 TTTTATGGCCAAGAAGAAGACGG + Intronic
1048228439 8:132613338-132613360 GTATTTGGCCATAAAAAGGAAGG + Intronic
1050412005 9:5376008-5376030 TTATTCAGCCATAAAAAGGAAGG + Intronic
1050719189 9:8565639-8565661 TAAAATGGACATCAAGAGGAAGG + Intronic
1050853849 9:10324457-10324479 TTATATGGCCAACAAGTAGATGG + Intronic
1051155354 9:14138034-14138056 TTATATAGCAATAACGAGCATGG + Intronic
1051499558 9:17762317-17762339 TTTTATGGTCCTAGAGAGGATGG + Intronic
1052063071 9:23984806-23984828 TTATTTAGCCATAAAAAGTATGG - Intergenic
1052291423 9:26845993-26846015 ATATATGGCCGTGAAAAGGAGGG + Intronic
1052434723 9:28411600-28411622 TTATTTGGCTACAAAAAGGAAGG - Intronic
1053481934 9:38422590-38422612 TGATATGGCCAGAGAGGGGAAGG + Intronic
1054803145 9:69372518-69372540 TTATATAGTCTTAAAAAGGAAGG - Intronic
1055193996 9:73564364-73564386 TTATGCAGCCATAAAAAGGAAGG + Intergenic
1056647019 9:88422207-88422229 TTATAAGGTCATTAAGAAGAAGG - Intronic
1058001258 9:99868355-99868377 TTATTTAGCCTTAAAAAGGAAGG - Intergenic
1059631898 9:116133998-116134020 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
1059783863 9:117559240-117559262 TTATTTGCCCATTAAGATGAAGG + Intergenic
1059853878 9:118373753-118373775 TTATAAAGTCATAAAGGGGATGG - Intergenic
1060034027 9:120239839-120239861 TTATTTGGCCTTAAAAAGGAAGG + Intergenic
1060081452 9:120650602-120650624 ATATATGGGCATAAAGAATAGGG + Intronic
1060475200 9:123981555-123981577 TTATTTGGCCATACAAAGGAAGG + Intergenic
1061778285 9:132980847-132980869 TTATTCGGCCTTAAAAAGGAAGG - Intronic
1186435251 X:9537642-9537664 TTATACAGCCTTAAAAAGGAAGG - Intronic
1187877792 X:23818484-23818506 TTATTTGGTCTTAAAAAGGAAGG - Intergenic
1187957516 X:24534320-24534342 TTATTTGGCCTTAAAAAGGAAGG + Intronic
1188051672 X:25495286-25495308 TTATGAGGTCATAAAGAGGAAGG + Intergenic
1188599828 X:31948201-31948223 TTATTTGGCCTTAAAAGGGAAGG - Intronic
1189024407 X:37376747-37376769 TTATATGGAAATCAAGAGGCTGG - Intronic
1189426352 X:40904915-40904937 TTATACAGCCTTAAAAAGGAAGG + Intergenic
1191726752 X:64289804-64289826 TTATTCAGCCTTAAAGAGGAAGG + Intronic
1192425718 X:71074310-71074332 GTATGTCACCATAAAGAGGAGGG + Intergenic
1192898178 X:75466703-75466725 TTATGTAGCCATAAAATGGAAGG + Intronic
1194157725 X:90414174-90414196 GTAGTTGGCCTTAAAGAGGAGGG - Intergenic
1194321717 X:92456704-92456726 TTATATGCGCAGGAAGAGGAGGG - Intronic
1194524642 X:94964874-94964896 TTATGCAGCCATAAAAAGGAAGG - Intergenic
1195302824 X:103548467-103548489 TTATTCGGCCATAAACAAGAAGG + Intergenic
1195651344 X:107288245-107288267 TTATTCAGCCATAAAAAGGAAGG - Intergenic
1195889336 X:109675001-109675023 ACAAATGGCCATATAGAGGATGG + Intronic
1196065846 X:111463443-111463465 TTATTTAGCCTTAAAAAGGAAGG + Intergenic
1196361072 X:114859509-114859531 TTATATAGACATTAAAAGGATGG - Intronic
1196644700 X:118104745-118104767 AAATGTGGCCACAAAGAGGATGG - Intronic
1196719682 X:118841585-118841607 TTATTTAGCCAGAAAAAGGAAGG - Intergenic
1196871145 X:120114874-120114896 TTATTTAGCCTTAAAAAGGAAGG + Intronic
1197079189 X:122392061-122392083 TTATCTGGCCTTAAAAAGTAAGG - Intergenic
1197505628 X:127300228-127300250 CTATGTGGCCATAAAAAGAATGG + Intergenic
1198165855 X:134056289-134056311 ATAATTGGCCATAAAAAGGAAGG - Intergenic
1198587797 X:138142091-138142113 TTTTATGGCCATAAAAAAGATGG + Intergenic
1199010315 X:142750357-142750379 CTATGCGGCCATAAAAAGGATGG - Intergenic
1199075417 X:143520253-143520275 TTCCATGGCCACAAAGAGCAAGG + Intergenic
1199527981 X:148813104-148813126 TTATTTGGTCATAAGGAGTAAGG + Intronic
1200504059 Y:3991149-3991171 GTAGTTGGCCTTAAAGAGGAGGG - Intergenic
1200629889 Y:5570182-5570204 TTATATGCACAGGAAGAGGAGGG - Intronic
1201523595 Y:14905045-14905067 TTATTCAGCCATAAAAAGGAAGG + Intergenic