ID: 1157572398

View in Genome Browser
Species Human (GRCh38)
Location 18:48721634-48721656
Sequence TCTGCACAATGGTGTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157572398_1157572404 9 Left 1157572398 18:48721634-48721656 CCCCAAGGACACCATTGTGCAGA 0: 1
1: 0
2: 0
3: 29
4: 158
Right 1157572404 18:48721666-48721688 TGCCATTAGATGCCATGTGATGG 0: 1
1: 0
2: 2
3: 14
4: 179
1157572398_1157572408 21 Left 1157572398 18:48721634-48721656 CCCCAAGGACACCATTGTGCAGA 0: 1
1: 0
2: 0
3: 29
4: 158
Right 1157572408 18:48721678-48721700 CCATGTGATGGCAGATACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1157572398_1157572406 20 Left 1157572398 18:48721634-48721656 CCCCAAGGACACCATTGTGCAGA 0: 1
1: 0
2: 0
3: 29
4: 158
Right 1157572406 18:48721677-48721699 GCCATGTGATGGCAGATACGAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157572398 Original CRISPR TCTGCACAATGGTGTCCTTG GGG (reversed) Intronic
900824561 1:4915832-4915854 TCTGCACACTGGAGTCACTGTGG + Intergenic
909669720 1:78174376-78174398 TCTAGACAATGTTTTCCTTGAGG + Intergenic
910670365 1:89766620-89766642 TTGGCACACTGGTGTGCTTGTGG - Intronic
911290044 1:96046338-96046360 GCTGCACAAAGGTGGCCTGGGGG + Intergenic
911686049 1:100779034-100779056 TCTGCTTACTGCTGTCCTTGGGG + Intergenic
912169688 1:107083624-107083646 TCTACAAAAAAGTGTCCTTGAGG + Intergenic
913415435 1:118600989-118601011 TCTGCTCCATGTAGTCCTTGAGG + Intergenic
917780355 1:178388743-178388765 TGTGTAAAATGGTGTCCTTTTGG + Intronic
1063472051 10:6295836-6295858 TCTTCACAATGGAGACCTGGTGG + Intergenic
1063812021 10:9722226-9722248 TCTCCACAATGGGGTGGTTGAGG + Intergenic
1064867423 10:19896649-19896671 TCTGCACAATGGTGGGCTTTTGG + Intronic
1069753486 10:70759915-70759937 GCTGCACACTGGAATCCTTGGGG - Intronic
1069772901 10:70910796-70910818 TCTGCAGGATGGTGTGCCTGAGG + Intergenic
1069905135 10:71727718-71727740 TCTGCAAAATGGGGTGCTAGTGG - Intronic
1073512012 10:104048444-104048466 TCTCCAAAATGGTGGCCTTCTGG + Intronic
1074254862 10:111791816-111791838 TCTGCTCAATGGTATACATGTGG - Intergenic
1075010578 10:118866265-118866287 TCTGCACAAAGGCCTCCCTGGGG - Intergenic
1075105482 10:119537474-119537496 TCTGTAAAATGGGGCCCTTGAGG - Intronic
1077600329 11:3570156-3570178 TCTGCACCCTGGTGTCCTGAGGG - Intergenic
1079491468 11:20993288-20993310 TCACCACAATGGGTTCCTTGTGG + Intronic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1085272215 11:75277114-75277136 TCTGGACAAAGCTGTCCTTGAGG - Intronic
1085517154 11:77118322-77118344 TCTGGAAGAAGGTGTCCTTGTGG - Exonic
1087644207 11:100788314-100788336 TCTCCACAATGTCCTCCTTGTGG - Intronic
1088139288 11:106596085-106596107 TCTGCACAATGGAAATCTTGGGG - Intergenic
1089626954 11:119757350-119757372 TCTGCACAACAGGGTCATTGTGG - Intergenic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1093973415 12:25395461-25395483 TTTGCACAATGGTGACATTTGGG - Intergenic
1096202426 12:49694447-49694469 TCTGCAGAATGGTTTCCTAAAGG + Intronic
1096648681 12:53051477-53051499 TCTGCACACAGGTCTCCATGCGG + Intronic
1097338245 12:58408671-58408693 TCTGCACAGTCATGTCCTGGAGG - Intergenic
1098975179 12:76895202-76895224 TGTTCACAATGGTGTTCCTGCGG - Intergenic
1102870575 12:116410980-116411002 ACTGCACACTGGTGACCCTGGGG - Intergenic
1103614304 12:122142408-122142430 TCTGCACACATGTGTCCTGGAGG - Exonic
1104035183 12:125092791-125092813 TGGGGCCAATGGTGTCCTTGTGG + Intronic
1105747114 13:23387719-23387741 TCTGCACCATGCTGTCCATTGGG - Intronic
1107028509 13:35827357-35827379 TCTGCTTAATGGTGTTATTGTGG - Intronic
1108621570 13:52190131-52190153 TCTGCAAAATGGAGACCTTAGGG - Intergenic
1108665118 13:52621747-52621769 TCTGCAAAATGGAGACCTTAGGG + Intergenic
1111673108 13:91353164-91353186 TTTGCAAAATGGTGTGCTTTTGG + Intergenic
1111794455 13:92899943-92899965 TCTGCAAAATGGGGTCATTATGG + Intergenic
1112230083 13:97581006-97581028 TTTGCACAATGTTGCCATTGGGG + Intergenic
1116932544 14:50704395-50704417 TCAGCACCATGGTCTCCGTGGGG - Intergenic
1117565490 14:56990368-56990390 TCTGCCCAATGGTGGCAATGAGG + Intergenic
1120552834 14:85892251-85892273 TCTGCACACTTATGTCCCTGTGG + Intergenic
1122149464 14:99717187-99717209 TCTGTAAAATGGGGGCCTTGAGG + Intronic
1127409417 15:58690988-58691010 TCTCCACAATGGGGTGGTTGGGG + Intronic
1128780843 15:70357636-70357658 TCTGCCCAGTGGTGTCCGAGGGG - Intergenic
1132811437 16:1800040-1800062 TCTGCACAGTGGTGGCTTTTTGG + Intronic
1133360891 16:5173077-5173099 TCAGCACAAAGGTCTCCTTGAGG - Intergenic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1137494320 16:48957915-48957937 TCTGGAGAATGTTGTCCTTGTGG + Intergenic
1138616816 16:58174802-58174824 ACTTCACAATGGTGTAATTGTGG - Intronic
1138710859 16:58969151-58969173 TCTTCATAATTGTGCCCTTGAGG - Intergenic
1139247496 16:65460179-65460201 TATGCACAAATGAGTCCTTGAGG + Intergenic
1143580060 17:7820250-7820272 GTTGCACAATGGTCTCCTAGAGG + Intronic
1143736586 17:8915810-8915832 TCTGCACACTCCTGTCCTTAAGG + Intronic
1148125260 17:45233389-45233411 CCTGCACAAGGCTGTGCTTGTGG + Intronic
1148515749 17:48215482-48215504 TCTGCCCAATGGTGTTCCTTCGG - Intronic
1149828684 17:59852152-59852174 TCTGGAGAGTGGTGTCATTGTGG - Intergenic
1151449059 17:74186307-74186329 TCAGGACAATGGTCACCTTGGGG - Intergenic
1153611125 18:6886285-6886307 TCTTCAAAATGGTGTCTTGGTGG - Intronic
1156101711 18:33604609-33604631 ACTGCATAACGCTGTCCTTGGGG - Intronic
1156797254 18:41061509-41061531 TATGGACAATGTTGTCATTGGGG - Intergenic
1157572398 18:48721634-48721656 TCTGCACAATGGTGTCCTTGGGG - Intronic
1158218824 18:55129005-55129027 TCTGCAGGATGGGGTCCTTGAGG + Intergenic
1158906705 18:62020040-62020062 TCTGCATAGGGGTGTCCTGGAGG + Intergenic
1161463134 19:4410916-4410938 TTAGCACAATGGTGTCCTTAAGG + Intronic
1167312287 19:48744022-48744044 TCTGCACCATGGATTTCTTGGGG - Intronic
1168557679 19:57356820-57356842 GCTGAACAAGTGTGTCCTTGCGG - Exonic
925044591 2:763154-763176 TCTGCACAGTGGTGTGCAGGTGG - Intergenic
925235955 2:2277353-2277375 TTTGCTCAAGGGTGACCTTGTGG + Intronic
926360062 2:12078553-12078575 ACTACACTCTGGTGTCCTTGAGG - Intergenic
926729145 2:16021923-16021945 ACAGCACAATGGTGACCTTGGGG - Intergenic
927273016 2:21233581-21233603 TGTACAGAATTGTGTCCTTGAGG + Intergenic
928374557 2:30764263-30764285 TCTGCACTATGGCTTCCTCGAGG - Exonic
931859252 2:66336566-66336588 TCTGCTCAAAGGTGACCCTGAGG + Intergenic
933047361 2:77556218-77556240 TCTGCTCAATGCTTTTCTTGGGG + Intronic
933586677 2:84186913-84186935 TCTGCAAAATGGAATTCTTGTGG - Intergenic
935222179 2:101024793-101024815 TCTGTAGAATGGGTTCCTTGAGG - Intronic
935225298 2:101047374-101047396 GCTGCAGAAAGGTGCCCTTGGGG - Intronic
937672541 2:124553749-124553771 TCTCCACAATGGTTGCCTTTTGG - Intronic
945929449 2:215840462-215840484 TGTGCACAGTGGTCTCCATGAGG - Intergenic
946122134 2:217525282-217525304 TCTGCAAAATGGGATTCTTGTGG + Intronic
946753556 2:222919138-222919160 TATGCACAATGATGCCCTTGGGG - Exonic
1171137172 20:22706381-22706403 TCTGCACAATGCTGAGATTGGGG + Intergenic
1175485012 20:59339548-59339570 TCTGCACATTTGTTTTCTTGTGG + Intergenic
1179723543 21:43329444-43329466 TCTGCACACTGGTGTCCAGGCGG + Intergenic
1179957916 21:44751475-44751497 TCTGCAAAATGGCGTCTTGGGGG + Intergenic
1180182014 21:46122237-46122259 TCTGCACAGAGGAGGCCTTGAGG - Intronic
1181808697 22:25390728-25390750 TCTCCACACTGGAGCCCTTGTGG - Intronic
1182303321 22:29351019-29351041 TCTGCACAATGCTTGCCATGGGG + Intronic
1182396585 22:30040694-30040716 ATTGCACAATGCTGCCCTTGGGG - Intergenic
1184036494 22:41920556-41920578 TCTGCAAAATGGGGCTCTTGAGG - Intergenic
1184339123 22:43876143-43876165 CCTGAGCACTGGTGTCCTTGGGG - Intergenic
951322317 3:21260265-21260287 TCTGCATACTTTTGTCCTTGGGG - Intergenic
951519512 3:23598236-23598258 ACTTCACGATGGTGGCCTTGGGG + Intergenic
953578608 3:44133499-44133521 TCTGCAGAAAGGAGCCCTTGGGG + Intergenic
954439528 3:50514147-50514169 TCTGCACTTTGGTGTGCATGAGG + Intergenic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
961529578 3:127532373-127532395 TCTGCACAATGGTGAGCTAAAGG - Intergenic
965662930 3:171061115-171061137 ACGTCAGAATGGTGTCCTTGTGG - Intergenic
966555083 3:181249990-181250012 TCTGCACCATGCTGTCCTCAGGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969329003 4:6462087-6462109 TCTGCAGAAAGGGGTCCTGGAGG + Intronic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
969798371 4:9543449-9543471 TCTGCACCCTGATGTCCTGGGGG + Intergenic
970034622 4:11718960-11718982 TTTGCATAATGTTGTCCTAGAGG + Intergenic
970175810 4:13338362-13338384 TCTCCACAATGGGGTGGTTGGGG - Intergenic
971080153 4:23200909-23200931 TCAGCACAATGATGTGCTTTGGG - Intergenic
980476532 4:133324723-133324745 TCTGCCCAATGGTGTCCATAAGG + Intergenic
980928179 4:139159267-139159289 ACTGAACAATGATTTCCTTGAGG + Intronic
983787180 4:171747707-171747729 TTTGCTCAATGATGTCCTTCAGG + Intergenic
985024870 4:185730970-185730992 TCTGTTGAATGGTGTCCATGAGG - Intronic
985957148 5:3274343-3274365 TCAGCACCATGGACTCCTTGAGG - Intergenic
987851930 5:23366025-23366047 TCAGCACAGTGGTGACCTTTGGG + Intergenic
988548774 5:32181701-32181723 ACTACACAATGAGGTCCTTGTGG + Intergenic
988689105 5:33554359-33554381 TCTGGACATTGGTGGTCTTGGGG + Intronic
989212434 5:38869079-38869101 TCTTAACATTGCTGTCCTTGAGG + Exonic
989361873 5:40610837-40610859 TGTGCACAATGGAATCCTTCAGG + Intergenic
992262055 5:74980595-74980617 TCTACTCAATATTGTCCTTGAGG + Intergenic
993458819 5:88158488-88158510 TCTGAACAATGCAGTCCTAGAGG + Intergenic
994684774 5:102935837-102935859 TCTGCACCAGACTGTCCTTGGGG + Intronic
996313944 5:122140378-122140400 TCTGCAAAATGTTACCCTTGAGG + Intronic
996942896 5:129030739-129030761 TCTGCAAAATGTTATCCTTGGGG - Intronic
998565494 5:143212707-143212729 TCTGCACGATGGAGACCATGTGG + Intronic
998574976 5:143305304-143305326 TTTCCACAGTGGTGTCATTGTGG - Intronic
1003412805 6:5880463-5880485 TCGGCACAATTGTGCTCTTGAGG + Intergenic
1004493880 6:16145056-16145078 TCTGTACAATGCTGGCGTTGTGG + Exonic
1005195561 6:23279532-23279554 TATGAACAATGATGTCCTTGAGG - Intergenic
1005777642 6:29153515-29153537 TTTGCACTGTGGTGTCCATGAGG + Intergenic
1007190928 6:40017797-40017819 TCTGGACAAAAGTGTCCTTGTGG + Intergenic
1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG + Intronic
1013042414 6:106448782-106448804 TCTGCACAGTAGTGTCCTTCAGG + Intergenic
1015629404 6:135216230-135216252 CCTGGACTTTGGTGTCCTTGCGG - Intronic
1016319887 6:142831168-142831190 TTTGCATCATGGTGCCCTTGTGG - Intronic
1018940906 6:168308439-168308461 CCTGCACCATGGTCTCCCTGAGG + Exonic
1019495835 7:1340234-1340256 TCTGCCCTAGGGTATCCTTGAGG + Intergenic
1019636211 7:2077416-2077438 TCAGTACAGTGGTGTCCTGGGGG - Intronic
1019636513 7:2078884-2078906 TCAGTACAGTGGTGTCCTGGGGG - Intronic
1020788617 7:12597529-12597551 AATGCTCAATGGTGCCCTTGAGG - Intronic
1022691733 7:32662643-32662665 TCTGCACACTGTTGTCAGTGTGG - Intergenic
1022919349 7:34996867-34996889 TCTGCACACTGTTGTCAGTGTGG - Intronic
1023629100 7:42145868-42145890 CCTGCTCCATGGTGTTCTTGTGG - Intronic
1023835455 7:44064940-44064962 CCCGGGCAATGGTGTCCTTGAGG + Exonic
1024274876 7:47669448-47669470 TCTGCACAAAGGTGTCCTCCAGG - Intergenic
1026619248 7:71935824-71935846 TCTGCCCAATGGTAGTCTTGAGG + Intronic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1031597226 7:123662291-123662313 TCACCACAGTGTTGTCCTTGAGG - Exonic
1034238360 7:149590351-149590373 TCTGCACAGTGGGGTACTTTGGG + Intergenic
1034398433 7:150845756-150845778 TCCTCACAAAGGTCTCCTTGGGG + Intronic
1036244264 8:7103150-7103172 TCTGCATCCTGGTGTCCTGGGGG + Intergenic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036361004 8:8076903-8076925 TTTGCACCCTGGTGTCCTGGGGG + Intergenic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1037257330 8:16970106-16970128 TCTGCACAATAATTTCCCTGTGG + Intergenic
1037808311 8:22070429-22070451 CCTGCCCTATGGTGTCCTCGTGG + Intronic
1039108476 8:34015862-34015884 TCTTCACAATGGAATCTTTGTGG - Intergenic
1040824164 8:51601297-51601319 TCTGTCCAATGTTGTCGTTGGGG + Intronic
1042851003 8:73216180-73216202 TCTCCACAATGGGGTGGTTGGGG + Intergenic
1043817488 8:84819680-84819702 TCAGCAAAATGTTCTCCTTGGGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046218878 8:111186428-111186450 TCTGCTCAATGGTTACCATGTGG + Intergenic
1052280092 9:26723104-26723126 TCTTCACAATGTAGTTCTTGCGG + Intergenic
1052723330 9:32199465-32199487 TCTTCACAACAGTGTCATTGAGG + Intergenic
1053160944 9:35813083-35813105 TCTGCACATTCATGTACTTGGGG - Exonic
1055096907 9:72423287-72423309 TATGCACAATTGTGTCCTTCTGG - Intergenic
1056045772 9:82714036-82714058 TCTGCCCAATTGTGTGCCTGAGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1057497043 9:95569610-95569632 TCTGCAAAATACTCTCCTTGTGG + Intergenic
1060803976 9:126563511-126563533 TCTGCATCCTGGTTTCCTTGTGG - Intergenic
1061047996 9:128177721-128177743 TCTGCAGAATGGTGACCTTCAGG + Exonic
1061763193 9:132864570-132864592 TCTTCCCAATGCTGTCATTGAGG - Intronic
1062434727 9:136541869-136541891 TGTGCACAATGGGGTCTCTGTGG + Intronic
1062454586 9:136629559-136629581 TCTGCACTTTGGTTTCCTGGTGG + Intergenic
1185925128 X:4137431-4137453 ACTGCAAAATGCTGTCCATGGGG + Intergenic
1190641539 X:52485195-52485217 TCTGCACAACGGTGACCATCCGG + Intergenic
1190646133 X:52527670-52527692 TCTGCACAACGGTGACCATCCGG - Intergenic
1191913301 X:66174579-66174601 TCTCCACACTGTTTTCCTTGTGG + Intronic
1199951256 X:152708037-152708059 TCTGCTAAAGTGTGTCCTTGAGG + Intergenic
1199955787 X:152741194-152741216 TCTGCTAAAGTGTGTCCTTGAGG - Intergenic
1199958427 X:152760424-152760446 TCTGCTAAAGTGTGTCCTTGAGG - Intergenic
1200700529 Y:6398383-6398405 TGTGGATCATGGTGTCCTTGTGG - Intergenic
1201033583 Y:9766315-9766337 TGTGGATCATGGTGTCCTTGTGG + Intergenic