ID: 1157572738

View in Genome Browser
Species Human (GRCh38)
Location 18:48723705-48723727
Sequence ACCTGTGCCCCTGTCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157572738_1157572741 8 Left 1157572738 18:48723705-48723727 CCAGGAGAGACAGGGGCACAGGT 0: 1
1: 0
2: 4
3: 35
4: 325
Right 1157572741 18:48723736-48723758 TACCAAGGAGCTTTCCTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 154
1157572738_1157572740 7 Left 1157572738 18:48723705-48723727 CCAGGAGAGACAGGGGCACAGGT 0: 1
1: 0
2: 4
3: 35
4: 325
Right 1157572740 18:48723735-48723757 ATACCAAGGAGCTTTCCTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 136
1157572738_1157572739 -7 Left 1157572738 18:48723705-48723727 CCAGGAGAGACAGGGGCACAGGT 0: 1
1: 0
2: 4
3: 35
4: 325
Right 1157572739 18:48723721-48723743 CACAGGTTTTAAAAATACCAAGG 0: 1
1: 0
2: 3
3: 39
4: 349
1157572738_1157572743 12 Left 1157572738 18:48723705-48723727 CCAGGAGAGACAGGGGCACAGGT 0: 1
1: 0
2: 4
3: 35
4: 325
Right 1157572743 18:48723740-48723762 AAGGAGCTTTCCTCCTGGGTCGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157572738 Original CRISPR ACCTGTGCCCCTGTCTCTCC TGG (reversed) Intronic
900176384 1:1293220-1293242 ACCTGTGTCCCTGTGTCCTCAGG - Exonic
900334771 1:2157020-2157042 AGCTGTGCCACTGGCTCTCCTGG - Intronic
900471419 1:2856811-2856833 CTCTGTGCCCCTGCCTCCCCTGG - Intergenic
900522991 1:3115187-3115209 CCCTGTGACCCCGCCTCTCCTGG + Intronic
900561173 1:3307745-3307767 CCCTGTGTCCCTGTTTCTGCAGG + Intronic
900653535 1:3743246-3743268 ACCTGTGCCCAGGTGTCTCAGGG - Intergenic
901196123 1:7440711-7440733 GCCTCTGCCCCTGTCTTTCTCGG - Intronic
901209993 1:7519284-7519306 CCCTGTGCCCCCACCTCTCCTGG - Intronic
901478288 1:9505859-9505881 ACCTCTGCCTCTGTCTTCCCAGG + Intergenic
901790293 1:11650289-11650311 ACCTGTGCCCTGGGGTCTCCCGG - Intronic
902255984 1:15188936-15188958 AGCTTTGCTCCTGCCTCTCCAGG + Intronic
902310443 1:15577864-15577886 ACCTCAGTCCCTGTCTCTGCAGG - Exonic
902385062 1:16071783-16071805 ACCTGGGCCCCAGCCTCTCAGGG + Intronic
902388940 1:16091635-16091657 ACCTGCGCCCCTCACTGTCCGGG + Intergenic
904585932 1:31580589-31580611 AGCAGTGCCCCCGCCTCTCCTGG + Intronic
905735632 1:40323915-40323937 AGCTGTGCCCTTCTCTCTCAGGG + Intergenic
906720201 1:47998487-47998509 CCTTGTGCTTCTGTCTCTCCTGG - Intergenic
907435343 1:54442355-54442377 GCCTGTGCCTCTGTCCCCCCAGG + Intergenic
908182654 1:61621691-61621713 ACCTGTGTCCCTTTTTCTCAGGG - Intergenic
910811650 1:91243226-91243248 ACCTGTGCCCAGCTTTCTCCTGG - Intergenic
911043856 1:93612754-93612776 ACTTGAGCCCCTTTCTGTCCTGG - Intronic
911097290 1:94065102-94065124 AGCTCTGCCACTGTCTCTCTGGG - Intronic
911864889 1:103006066-103006088 ACCTTTGCCCCAGGTTCTCCTGG + Exonic
913259369 1:116984738-116984760 TCCTGTGCTCCTGTCTTCCCTGG + Exonic
914804945 1:150984820-150984842 ACCAGTGCCTCAGTCTCTCAGGG + Intronic
915171633 1:153982176-153982198 ACCTGTGCCCTTCTCCCTCTAGG - Exonic
915313470 1:155015917-155015939 ACCCATGCCCCAGTCCCTCCAGG - Intronic
916434828 1:164768367-164768389 CCCTGTGCCCCTCTGTGTCCTGG - Intronic
917279209 1:173363835-173363857 ACCTTTGCCCCTTTCTATCAGGG - Intergenic
917977284 1:180248343-180248365 AGCTGTGCCAGTGTCTGTCCAGG - Exonic
919466505 1:197926659-197926681 AGCTGTGCCCCTGGCTGGCCTGG - Intronic
920263103 1:204703093-204703115 ACCTGTGCCCCTTTCTCTGGAGG + Intergenic
921414675 1:214871852-214871874 ACCTGGGCCCCTCCCTCTTCAGG - Intergenic
924118550 1:240772415-240772437 AGCTGTGCCCTTGGTTCTCCTGG - Intergenic
924172738 1:241358119-241358141 ACCTGTGCCTCTGGCTTTCAGGG + Intergenic
1063055011 10:2495402-2495424 CCCTGTGCTCTTGTCTCCCCTGG + Intergenic
1063221415 10:3971940-3971962 GCCTGTGCACCTGCCTCTTCTGG + Intergenic
1063526075 10:6787160-6787182 CCCTGCGCCCCTGTCTATCAGGG - Intergenic
1071431873 10:85612893-85612915 AGCCTTGCCCCTGTCCCTCCTGG - Intronic
1073081803 10:100865271-100865293 CCCTCTGCCCCTGTTTGTCCTGG + Intergenic
1074222370 10:111450683-111450705 AGCAGTGCCCCTGTCCCTACAGG + Intergenic
1074634902 10:115304090-115304112 CCCTCTGACCCTTTCTCTCCAGG + Intronic
1075494463 10:122907870-122907892 ACCTGTGCCTCTGTCTCCCCTGG + Intergenic
1075697802 10:124448970-124448992 ACCTGAGCCTCTGACCCTCCAGG + Intronic
1075698854 10:124455512-124455534 ACCTGTCTGCCTGTCTCTCGTGG - Intergenic
1077119557 11:900553-900575 ATCTGTGCCCCTGTAGCTCACGG - Intronic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1077478888 11:2803716-2803738 TCCTGTGCCCTTCTTTCTCCTGG + Intronic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1079922398 11:26449005-26449027 TTCTGTGCTCCTGTCTCTCCAGG + Intronic
1081936123 11:46905088-46905110 CCCAGTGCTCCTGTCTCTTCGGG + Intronic
1082896842 11:58200830-58200852 ACCTGTCCCACTCTCTCTCTCGG - Intergenic
1082996815 11:59261782-59261804 AGATGTGCCCTTGTCTCTCAGGG - Intergenic
1083231328 11:61322298-61322320 GCCCCTGCCCCTGCCTCTCCAGG + Exonic
1083320110 11:61840602-61840624 ACGTGTGACCCTCTCTCCCCAGG + Exonic
1084277786 11:68063814-68063836 CTCTCTGCCCCTCTCTCTCCTGG + Intronic
1084588991 11:70079341-70079363 ACCCTCGCCCCTGTCTCCCCTGG + Intronic
1084679212 11:70656322-70656344 ACATGGGCCTCTGTCACTCCTGG + Intronic
1084788275 11:71456738-71456760 AGCTGGGCCCCTGTCCCTGCTGG - Intronic
1084794711 11:71497354-71497376 ACCTCTGCTCCTGCCTCTCTGGG + Intronic
1084953983 11:72681722-72681744 GCCTGTGCCACTGTGTCTCCAGG + Intergenic
1085020232 11:73202083-73202105 ACCCCTTCCCCTGGCTCTCCTGG + Intergenic
1088188759 11:107204108-107204130 ACCTGTCCCCGTGTTTCTGCTGG - Intergenic
1089679911 11:120113551-120113573 GCCTTTGGCCCTGTCTCTCAGGG + Intronic
1090188076 11:124751366-124751388 TCCTGGGCTCCTGTCCCTCCAGG + Intronic
1091434591 12:462432-462454 ACCTCTGCCTCTGTCTCCCGTGG + Intronic
1091823056 12:3490894-3490916 AACTGTGGCCCGGTCTCGCCCGG + Intronic
1093005119 12:14043285-14043307 GCCTGAGCCCCTGTATCTGCCGG - Intergenic
1096043398 12:48540519-48540541 AGGTGTGGCCCTCTCTCTCCTGG - Intergenic
1097053325 12:56236575-56236597 CCCTGAGCCCCTGGCTCTGCGGG - Exonic
1099277243 12:80592121-80592143 ACCATTTCCCCTGTGTCTCCTGG - Intronic
1102226120 12:111229473-111229495 ACCTGGGCCCATCTTTCTCCTGG - Intronic
1102720945 12:115015451-115015473 ACCTGAGCCACTGTTTCTCATGG + Intergenic
1103477894 12:121232211-121232233 CCCTGTGCCCCTGTACCTCGTGG + Intronic
1103831870 12:123786740-123786762 ACCTCAGCCTCAGTCTCTCCAGG - Intronic
1103885745 12:124198915-124198937 ACCTGAAACCCTGTCTCCCCAGG + Intronic
1103924115 12:124414266-124414288 CCCTGTGCCTCTGTCTCATCTGG + Intronic
1104750685 12:131236193-131236215 ACCAGTGCCCATCCCTCTCCAGG - Intergenic
1104842111 12:131830266-131830288 ACCTGCGCCTCGGTCTCTCCTGG + Intronic
1107480100 13:40779218-40779240 ACCAGAGCCCCTGTAGCTCCCGG + Intergenic
1108543545 13:51467614-51467636 AACTATGCCACTGACTCTCCTGG + Intergenic
1111460600 13:88536603-88536625 ATTTGTGCCATTGTCTCTCCTGG - Intergenic
1113469757 13:110536070-110536092 GTCTTTGCCCCTGTGTCTCCGGG - Intronic
1113533222 13:111044841-111044863 GACTGTGCCCCTGCCTCTCCAGG - Intergenic
1113789945 13:113022961-113022983 ACCTCTGCCCCCGTCTCTGGTGG - Intronic
1113951176 13:114071784-114071806 ATATGAGCCCCAGTCTCTCCAGG + Intronic
1114356197 14:21911957-21911979 ACATGTTCCCATGTTTCTCCAGG - Intergenic
1116537585 14:46053995-46054017 ACCTGTTCCTCTGTTTCTGCAGG + Intergenic
1116786435 14:49293818-49293840 ACCTGGGCGCCTGGCTCTGCAGG - Intergenic
1118244599 14:64097457-64097479 ACATGTTCCCATGTCTCTCCAGG - Intronic
1119272147 14:73316422-73316444 ACTTGTCCCCCTGTTCCTCCAGG - Exonic
1120119959 14:80667151-80667173 TCCTGTGTCCCTTTCTCTACTGG - Intronic
1120385879 14:83845244-83845266 ACTTGCCTCCCTGTCTCTCCTGG - Intergenic
1122283821 14:100639297-100639319 ACTGCTGCCCCTGTCTCCCCTGG - Intergenic
1122295104 14:100701070-100701092 GGCTGAGCCCCTGTCTCTGCTGG + Intergenic
1122350175 14:101084429-101084451 ACCTGAGCCCCAGTCCTTCCAGG - Intergenic
1122938213 14:104969713-104969735 CCCTGTGCCTCAGTTTCTCCAGG - Intronic
1123467005 15:20524988-20525010 ACCTGTGCTCCTGGCTCAACGGG + Intergenic
1123651109 15:22476054-22476076 ACCTGTGCTCCTGGCTCAACGGG - Intergenic
1123741519 15:23284896-23284918 ACCTGTGCTCCTGGCTCAACGGG - Intergenic
1123745478 15:23317662-23317684 ACCTGTGCTCCTGGCTCAACGGG + Intergenic
1124267504 15:28250063-28250085 ACCTGTGCTCCTGGCTCAACGGG - Intronic
1124277750 15:28340979-28341001 ACCTGTGCTCCTGGCTCAACGGG + Intergenic
1124304950 15:28570629-28570651 ACCTGTGCTCCTGGCTCAACGGG - Intergenic
1124558055 15:30746039-30746061 TCCTTTGCCCCTGGCTCTGCAGG - Intronic
1124670439 15:31634102-31634124 ACCTGTGCCCAGGTCTCTCCTGG - Intronic
1124673189 15:31659610-31659632 TCCTTTGCCCCTGGCTCTGCAGG + Intronic
1126865421 15:52932079-52932101 ACCTGCCCACCTGTCTCTTCTGG - Intergenic
1128090579 15:64916181-64916203 ACCTTTGACCCTGGCCCTCCTGG - Intronic
1128903490 15:71446996-71447018 TCCTGTGTCCTTGTCTCCCCCGG - Intronic
1129671641 15:77610987-77611009 GCCCGTGCGCCGGTCTCTCCTGG + Intergenic
1130256728 15:82329285-82329307 ACCTGTGGCCCTGTGCCACCTGG + Intergenic
1130598222 15:85260703-85260725 ACCTGTGGCCCTGTGCCACCTGG - Intergenic
1131072104 15:89472497-89472519 ACCTGTTCCTGTGTCTGTCCTGG + Intronic
1131155108 15:90070056-90070078 ACTTGTGACCCTGTCTCTCACGG + Intronic
1131872657 15:96777889-96777911 ACCTCTGTCTCTGTCTCTCCAGG + Intergenic
1132569914 16:639821-639843 AGCTGTGCCCAGGCCTCTCCTGG - Intronic
1132599977 16:769033-769055 TCCTGTGCCCCTGTCCCCACAGG + Intergenic
1132672899 16:1108961-1108983 CCCTGTGTCCCTGTCTCTGTGGG - Intergenic
1132767762 16:1543115-1543137 CTCTGTGTCCCTGTCTCTGCGGG - Intronic
1133194338 16:4158217-4158239 ACCTCTGCCCCTGTTTCTCCTGG + Intergenic
1133255212 16:4512403-4512425 ACCTGAGCCGCTGACTCTTCTGG - Exonic
1134245005 16:12533323-12533345 ACCTGTGGCCCTGTGGGTCCTGG + Intronic
1134638389 16:15809843-15809865 ACCTGAGCCTCAGCCTCTCCAGG - Intronic
1135417541 16:22280171-22280193 ACCTTTCCCTCTGTATCTCCTGG + Intronic
1136024343 16:27460419-27460441 GCCTGTGCCCCTCTCCATCCTGG + Intronic
1136169384 16:28479077-28479099 CTCTGTGCCCCAGTCTCTCAAGG + Intronic
1136365816 16:29808759-29808781 CCCTCTGCCCCTGGCCCTCCCGG - Intronic
1136775417 16:32869162-32869184 ACGTGTTTGCCTGTCTCTCCTGG + Intergenic
1136895199 16:33992350-33992372 ACGTGTTTGCCTGTCTCTCCTGG - Intergenic
1137605157 16:49782156-49782178 CTCTGTGCCCCGGTCACTCCTGG - Intronic
1138531580 16:57637383-57637405 AGCTGTGCCTCTGTTTCTCCGGG + Intronic
1139279011 16:65753863-65753885 ATCTATGCCCCTGTCTCTGCAGG - Intergenic
1140346417 16:74217892-74217914 CCCTTTGGCCCTGTCTCTCTAGG - Intergenic
1141511516 16:84515091-84515113 ACCTGGGTCCCTGCCTCTGCAGG + Intronic
1142406305 16:89892171-89892193 ACCTGTGTCCCGTTCTCCCCAGG + Exonic
1203077834 16_KI270728v1_random:1131271-1131293 ACGTGTTTGCCTGTCTCTCCTGG + Intergenic
1142810793 17:2394730-2394752 CACTGTGCCCATGTCTATCCTGG - Intronic
1142905990 17:3042267-3042289 ACCAGTGCCCCTCTTTGTCCTGG + Intergenic
1143287250 17:5799530-5799552 ACCTGTGCCCCACTCTCTGAGGG + Intronic
1143598918 17:7931576-7931598 AACTCTGCCCCTCTCCCTCCAGG - Exonic
1143739525 17:8942234-8942256 ACCTGTGCCCCTTCCTATCTTGG + Intronic
1144507170 17:15842208-15842230 AGCTGTGCGTCTTTCTCTCCCGG + Intergenic
1144604773 17:16655166-16655188 ACCTGTGTGTCTGTCTTTCCTGG - Intergenic
1145055649 17:19702272-19702294 ACCTGTGCCCCAGGCTGGCCAGG - Intronic
1145239763 17:21233811-21233833 GCCTGTGGCCCTGCATCTCCTGG + Intergenic
1146494605 17:33310302-33310324 CTCTGTGCCTTTGTCTCTCCAGG + Intronic
1147169983 17:38612488-38612510 CCCTGTTCTCCCGTCTCTCCAGG - Intergenic
1147872894 17:43600145-43600167 TCTTGTCCCCCTGTCTCTCTTGG + Intergenic
1148051485 17:44772064-44772086 TCCTTTGCCCCTGTCTCTCAGGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150385465 17:64755997-64756019 GCCAGTATCCCTGTCTCTCCAGG + Intergenic
1152198898 17:78933895-78933917 ACCTGCGACTCTGGCTCTCCTGG + Intergenic
1152341653 17:79729097-79729119 ACCTGTGTCCCTGACTCACAGGG + Intergenic
1153275977 18:3368281-3368303 CCCTGTGCCCCTGGCACTCTGGG + Intergenic
1156673746 18:39502393-39502415 ACCTGTGTCTCTGCCTCTCTGGG + Intergenic
1157572738 18:48723705-48723727 ACCTGTGCCCCTGTCTCTCCTGG - Intronic
1160693797 19:472764-472786 ACCTGTGACCGTGTATCTCTGGG - Intronic
1160868002 19:1264567-1264589 AGCTGGGCCCCTGACCCTCCAGG + Intronic
1161121458 19:2529092-2529114 AGCTCTGCCCAGGTCTCTCCAGG - Intronic
1161318711 19:3631363-3631385 ACCTCTGCCCCTGCCTCCCCGGG + Exonic
1161847021 19:6718052-6718074 GCCTGTGCCCCTGCTTCCCCTGG + Intronic
1162382603 19:10340319-10340341 CCCTGAGCCACTGTCTATCCAGG + Intergenic
1163352029 19:16783154-16783176 ACCTGTGCTCCTAGCTCTTCAGG - Intronic
1163367518 19:16883968-16883990 TGCTGTGACCCTGTCTCACCAGG - Intergenic
1164596448 19:29533512-29533534 ACCTGTGTCCCTCACTCTCCAGG + Intronic
1165058395 19:33193640-33193662 AACCTTCCCCCTGTCTCTCCTGG + Intronic
1165093056 19:33396632-33396654 TCCTGTGCCCCTGTCACTGGGGG - Intronic
1165206429 19:34192217-34192239 ACCTGTGCCACTGTCTTTCCTGG + Intronic
1165798797 19:38535137-38535159 ACCATGGCACCTGTCTCTCCTGG - Exonic
1167284259 19:48590060-48590082 ACCTCTGCCCCTCTGCCTCCAGG + Intronic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1167715728 19:51141935-51141957 ACCTGCACCCCTGTCTCTCATGG + Intergenic
1167762607 19:51458814-51458836 ACCTGCACCCCAGTCTCTCATGG - Intergenic
1168287704 19:55342677-55342699 ATCTTTGGCCCTCTCTCTCCAGG - Intronic
1168405299 19:56107541-56107563 CCCTGTGACCCCGTGTCTCCTGG - Intronic
1168468935 19:56625483-56625505 CCCTGTGTCCCTGTGTCCCCAGG + Exonic
925745192 2:7038164-7038186 ACCTGGCCCCCTGTCCTTCCTGG - Intronic
925919873 2:8631353-8631375 CCCTGCCACCCTGTCTCTCCGGG - Intergenic
926021923 2:9504024-9504046 ACCTGTAGTCCTGTCTATCCGGG + Intronic
926127824 2:10282803-10282825 ATCTTTGCCCCAGTTTCTCCAGG - Intergenic
927603041 2:24461261-24461283 CTCTGTGCCCCTGTCTTGCCAGG + Intergenic
927980614 2:27372494-27372516 CCCTGTTCCCCTGTCTACCCTGG - Intronic
928358333 2:30641223-30641245 ACCTGTGCCCTTTTCTCTCGTGG + Exonic
928583187 2:32729447-32729469 ACCTGTGACACTGTGGCTCCTGG + Intronic
929546353 2:42857383-42857405 CCCTGTGCCCCTGTCCCCCAGGG + Intergenic
931787974 2:65638656-65638678 TCCTTTGCCACTGTCTCTCTGGG - Intergenic
932332771 2:70907436-70907458 ATCTGTGCCCCTGCCCCTGCCGG + Intronic
932413619 2:71561093-71561115 ACCTGACCTCCTGTCTCTCAGGG + Intronic
933592013 2:84243581-84243603 ACCTGTGCAGATGACTCTCCTGG + Intergenic
935513532 2:104005740-104005762 ACCTCTGCTCCTGTCTTTACTGG - Intergenic
937903092 2:127037698-127037720 CCCTGTGCCCTTGTATCTTCTGG + Intergenic
938925545 2:136037984-136038006 ACCCTTGCCCCTCTCTCTCCTGG + Intergenic
940825306 2:158405160-158405182 CCCTGTTCCCCTGTTCCTCCTGG - Intronic
942140570 2:172973481-172973503 ACCTGTGCCCCTATCTGGCTAGG - Intronic
944502775 2:200378973-200378995 ACCTTTGCGCCTGACTCTCTGGG + Intronic
945096403 2:206223465-206223487 ACCTGTACCTCTGCCACTCCAGG - Intergenic
947698425 2:232212405-232212427 ACCTGTTCCTCTGTCTCAGCTGG + Intronic
947805589 2:232965857-232965879 ACCTGTGCCCCCTTCTGTCTTGG - Intronic
947923262 2:233897912-233897934 TCCTGTGCCCCTTTCTCTGCTGG - Intergenic
948936757 2:241170540-241170562 ACCTGTGCCGCAGTCTCTGCAGG - Intronic
949026230 2:241767688-241767710 CCATGTGCCCTTGTCCCTCCAGG + Exonic
1169310286 20:4532239-4532261 TCCTGTGCACGTGTCTGTCCTGG + Intergenic
1169351583 20:4872466-4872488 ACCTGTACAGCTGCCTCTCCTGG + Intronic
1169436490 20:5596719-5596741 TGCTGTGCCCCTGTCTTTCAGGG - Intronic
1170155224 20:13263027-13263049 ACCTGTGTCACTGGCTCTCAGGG + Intronic
1170733723 20:18995439-18995461 ACCTGTGTCCCTGCATCGCCAGG + Intergenic
1171426320 20:25050907-25050929 CCCTGTGTCCCTGTCTTTCCAGG + Intronic
1172527061 20:35606286-35606308 ACCTGCATCCCTGTCTCCCCAGG + Intergenic
1172682950 20:36731121-36731143 ACCTGTGCTCAGGTCTCTCTTGG - Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1173140584 20:40478434-40478456 TCCTGTTCCCCTGAATCTCCAGG - Intergenic
1175051792 20:56162256-56162278 ACCTGGACCCCTGTCACTTCTGG - Intergenic
1175610855 20:60349960-60349982 ACCTGTGCTCCCGGCTATCCAGG - Intergenic
1175911289 20:62406673-62406695 ACCTGAGCCCCTGTCAACCCAGG - Intronic
1175951523 20:62586158-62586180 ACCTGTGCCCCTGAGGCCCCTGG - Intergenic
1176027949 20:62995647-62995669 CCCTGTGCCCCTGTGACCCCTGG - Intergenic
1176127737 20:63483416-63483438 TCCCTTGCCCTTGTCTCTCCCGG - Intergenic
1177594432 21:23217651-23217673 TCTTGTGCCTCTGCCTCTCCAGG - Intergenic
1179127022 21:38599537-38599559 ACCTCTGCCTCTGGTTCTCCAGG - Intronic
1180855348 22:19041706-19041728 GCCTCTGCCCCTCTCTGTCCAGG + Intronic
1180899766 22:19361726-19361748 GCCTGTGTCTCTGTCTGTCCAGG - Exonic
1181046712 22:20218078-20218100 AGCTGGACCCCGGTCTCTCCTGG + Intergenic
1181332028 22:22100242-22100264 ACCTGTGGCTCTGGCTCTCAGGG + Intergenic
1182334005 22:29570957-29570979 ACCTGTACACCTCACTCTCCAGG + Intronic
1183479908 22:38057724-38057746 TCCTATGCTCCTTTCTCTCCCGG + Intronic
1183494545 22:38135084-38135106 ACCGGGGCCCCTCTCTCACCAGG - Exonic
1184144322 22:42599930-42599952 ACTTGGGCCCCAGTCTTTCCAGG - Intronic
1184160899 22:42696801-42696823 ACCTGTGCCCCAGCCACACCTGG + Intronic
1184818875 22:46893666-46893688 ACCTGGGCCCTTGTCCCTGCTGG + Intronic
1184945636 22:47801970-47801992 ACCTGTGCACCTGCCCCTCCAGG + Intergenic
1185096009 22:48806429-48806451 CCCTCTGCCCCTGGCTGTCCTGG - Intronic
1185150316 22:49160507-49160529 ACCTGAGCCCCCCTCTCTCCAGG + Intergenic
1185150363 22:49160670-49160692 ACCTGAGCCCCCCTCTCTCCAGG + Intergenic
1185215760 22:49599181-49599203 CCCGGTGACCCTTTCTCTCCTGG - Intronic
1185372623 22:50468069-50468091 TCCTGGGCCTCAGTCTCTCCGGG + Intronic
1185398857 22:50605779-50605801 CCCTGTGCCCCTGCCTGACCTGG + Intronic
950330779 3:12154495-12154517 ACCTGGGCCCCTGGGGCTCCAGG - Intronic
950446820 3:13043298-13043320 ACCTCTCCCCTTGTATCTCCTGG + Intronic
950556508 3:13699250-13699272 TCCTGTCCCCCAGTCTCTGCAGG + Intergenic
950693084 3:14676289-14676311 AACTGTGCCACTGTCTTTGCTGG + Intronic
950704579 3:14771967-14771989 ACTTGTGTCCTTGTCTGTCCAGG + Intronic
950736949 3:15017005-15017027 GCCTGTGCCCCTGGCATTCCTGG - Intronic
953168048 3:40482684-40482706 ACCTGTGCACATGCCTCTCAGGG - Exonic
953200876 3:40777558-40777580 ACCTATGCCACTGGCTCTCCTGG - Intergenic
954005903 3:47590472-47590494 ACCTGTGCACCTGTCCATCAGGG + Intronic
954132224 3:48566658-48566680 ACCTGCTCCCCTCTCTCGCCAGG + Exonic
954286781 3:49625075-49625097 CCCTGTGCCCTTGTCTCTCGGGG - Exonic
956411100 3:68980715-68980737 ACATGTGCCTCAGTTTCTCCAGG + Intronic
956498124 3:69850726-69850748 GCCTGAGCCACTGTCTATCCAGG - Intronic
958577694 3:95973894-95973916 CCCTGTGTCCCAGACTCTCCTGG + Intergenic
958890246 3:99775201-99775223 ACCTGGGCTCCAGTCTCTCCTGG + Intronic
960940146 3:122928083-122928105 TCCTGTGCCCCAGTCTCTCTGGG + Intronic
962792675 3:138825675-138825697 ACCCTTGCATCTGTCTCTCCAGG + Intronic
964567933 3:158077836-158077858 CCCTTTCCCCCTGACTCTCCTGG - Intergenic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
965937366 3:174130649-174130671 ACCTTTGCCATTTTCTCTCCTGG - Intronic
968281804 3:197482840-197482862 CCTTCTGCCTCTGTCTCTCCTGG - Intergenic
968600995 4:1509238-1509260 CCCTGTGCTGCTGTCCCTCCAGG - Intergenic
968705283 4:2074769-2074791 ACCTGTGCCCCCAGTTCTCCAGG - Intronic
969398807 4:6939988-6940010 GCCTGTGCCCCTGGCTCCCGCGG + Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
972020833 4:34311342-34311364 ACCTGTCTTCCTGTATCTCCTGG - Intergenic
972664055 4:41146729-41146751 ACCTGTCCTCCTCTCTCCCCTGG - Intronic
972942086 4:44208302-44208324 ACATCTGCCCCTGTGTATCCTGG + Intronic
977991388 4:103446648-103446670 GCCTGTGTCCCTCTCTCTCCTGG - Intergenic
981748232 4:148070930-148070952 ACCTGTGCCCTTTGCTGTCCAGG + Intronic
981965020 4:150590086-150590108 ACCTGTGGCTCTGTCCCTCAAGG - Intronic
982176880 4:152714273-152714295 ACCACTTTCCCTGTCTCTCCAGG + Intronic
982436256 4:155385100-155385122 AACTGTGCCCCTCTCTTCCCAGG + Intergenic
983758021 4:171365942-171365964 ACTTGGGCCCCTAACTCTCCAGG - Intergenic
984844777 4:184100178-184100200 ACCTGTGCACCTGACCCGCCAGG - Intronic
985439793 4:189972643-189972665 CCCTGAGACCCTGTCTCTACGGG + Intergenic
985713265 5:1442129-1442151 AGCTTTGCCACTCTCTCTCCTGG + Intronic
985881957 5:2645169-2645191 ACCTGTGACCCTGTCCTCCCGGG + Intergenic
985967543 5:3349018-3349040 GCCTGTGCCCCTGCCCCTCCTGG - Intergenic
986031387 5:3896265-3896287 GCGTGTGCCTCTGCCTCTCCAGG + Intergenic
986307289 5:6525122-6525144 AGCTGTGCCCCTCTCTCCACAGG + Intergenic
986813716 5:11385383-11385405 ACCTGCGCCCCGAACTCTCCTGG + Intronic
987622329 5:20351438-20351460 ATCTGTGCCTCTGTATCTTCAGG - Intronic
989129754 5:38095275-38095297 GGCTTTGCCCCTGTGTCTCCCGG - Intergenic
989216303 5:38907918-38907940 ACGTGTGGCCCTGCCTCCCCTGG + Intronic
989367503 5:40673356-40673378 ACATGTGCCCATGCCTCTTCAGG + Intergenic
994825927 5:104712802-104712824 AACTGTACCCATGTCTCTGCTGG + Intergenic
999160307 5:149490650-149490672 TCATTTGCCCCTTTCTCTCCTGG + Intergenic
999762591 5:154713908-154713930 ACCTGTTCCCATCACTCTCCTGG - Intronic
1001248500 5:170124855-170124877 ACCTGTCCCACTGTCTCAGCAGG + Intergenic
1001921313 5:175602125-175602147 ACTTGTTCCCTTGTCTGTCCGGG + Intergenic
1002700567 5:181121614-181121636 TCCTTTGCCCCCGTCTTTCCAGG - Intergenic
1005001874 6:21249747-21249769 CCTTGTGCCCCTCACTCTCCAGG + Intergenic
1005954874 6:30656759-30656781 GCCTGTTCCCCTTTCTTTCCAGG - Exonic
1007423510 6:41733709-41733731 TCCTCTGCCTCTGCCTCTCCTGG + Intronic
1008447077 6:51605242-51605264 TCCTGTGCCCCTGTCTCAGCAGG + Intergenic
1010473110 6:76253371-76253393 ACCTTTACCCCTCTCTCTCAAGG - Intergenic
1017875876 6:158523929-158523951 TGCTGTGCTCCTGTCGCTCCTGG - Intergenic
1018096510 6:160391745-160391767 ACGTCAGCCCCTCTCTCTCCAGG - Intronic
1018199858 6:161384636-161384658 CTCTGTTCCCCTGTGTCTCCAGG - Intronic
1018268749 6:162053900-162053922 ACCTGTGCCCCTGCCTTTCAGGG - Intronic
1019129636 6:169864336-169864358 CTCTGTGGACCTGTCTCTCCCGG - Intergenic
1019168509 6:170115365-170115387 GACTGTGCCCCTGTGTTTCCAGG - Intergenic
1023202383 7:37712519-37712541 ACCTGCCCCTCTGTTTCTCCAGG + Intronic
1023563926 7:41504868-41504890 ATCGGTGCCCCTGTAGCTCCAGG + Intergenic
1024715188 7:52071431-52071453 AACTGTGCCACTGTCTTTCCTGG + Intergenic
1025262121 7:57426443-57426465 ACCTGTGAACCTGGCTCCCCAGG + Intergenic
1026000819 7:66558105-66558127 ACCTGTGAGCCTGGCTCCCCAGG + Intergenic
1026335293 7:69389243-69389265 CCCTGTGTCCCTGTCACTTCAGG - Intergenic
1027829320 7:83157077-83157099 GTCTGTGTCCCAGTCTCTCCTGG - Intronic
1029576814 7:101408824-101408846 ACCCAGGCCCCTGTCTCTGCTGG + Intronic
1029688746 7:102166390-102166412 CCCAGTGGCCCTGTCTCTGCAGG + Intronic
1030837898 7:114311441-114311463 AACCCTGCCCCTGTCTCTCTTGG - Intronic
1032002081 7:128272014-128272036 CCCTGTGCCCCTTTCTGACCCGG + Intergenic
1032480649 7:132244084-132244106 ACTTGTGTCCCTGTCTCACATGG - Intronic
1033615162 7:143007387-143007409 ACCTCTGCCCCAGGCTCTTCTGG + Intergenic
1034337426 7:150332460-150332482 GCCTGTTCCCTTGCCTCTCCTGG + Exonic
1034404896 7:150896743-150896765 CCCTCTGCCCCTGCCTCTCTGGG - Intergenic
1034674705 7:152884091-152884113 TCCTGCACCCCTGCCTCTCCTGG - Intergenic
1034960239 7:155360242-155360264 GCCAGTGCTCCTGTCTCCCCAGG + Intronic
1034969896 7:155412446-155412468 TGCTGTGCCTCTGTTTCTCCAGG - Intergenic
1035056358 7:156039237-156039259 TCCTGTGCTCCTGTCTCCCGCGG - Intergenic
1035115822 7:156523077-156523099 ACCTGTGCCCCTGGATCAGCGGG - Intergenic
1035191959 7:157177707-157177729 TCCTCACCCCCTGTCTCTCCTGG + Intronic
1035202882 7:157278329-157278351 ACCTGTGGGCCTGTCTGTCTGGG - Intergenic
1035605305 8:926527-926549 ATCTGTGCCCATTGCTCTCCTGG + Intergenic
1037307347 8:17519529-17519551 CCCTTTGGCCCTGTCCCTCCGGG + Intronic
1037617336 8:20531313-20531335 ACCTGAGCCTATGTGTCTCCTGG - Intergenic
1038422412 8:27441855-27441877 AGCTGTGCAGGTGTCTCTCCTGG + Intronic
1039909205 8:41810775-41810797 TCCTGTTCTCCTGGCTCTCCCGG - Intronic
1041138652 8:54789525-54789547 ACCTGTGTCCCTGCCTGACCAGG + Intergenic
1045026642 8:98093217-98093239 ACCTTTTCCCCTGTCTCACCTGG - Exonic
1049255637 8:141612230-141612252 ACCTGTGGCCCTGTCTGGGCTGG + Intergenic
1049307078 8:141909782-141909804 ATCTGTGTCCTTGTCACTCCTGG - Intergenic
1049775411 8:144401644-144401666 ACCTGTGCTCCTGTCATTCTTGG + Exonic
1050297599 9:4221687-4221709 ATCTTTGCCCCTTTCTCTTCTGG - Intronic
1052866119 9:33465651-33465673 ACCTAGCCACCTGTCTCTCCAGG - Intronic
1053056863 9:34998083-34998105 ACCTGTGACCCTGAATCTCTTGG - Exonic
1053416574 9:37950573-37950595 CCCCGTGCCTCTGCCTCTCCTGG - Intronic
1057180310 9:93026275-93026297 AGCTGGGCCCAAGTCTCTCCAGG - Intronic
1057195617 9:93114479-93114501 ACCTGAGGCCCTGACTCCCCAGG + Intergenic
1057720014 9:97524635-97524657 AACTGTGCCATTGGCTCTCCTGG - Intronic
1058788508 9:108416772-108416794 ACCTGAGCCCCTTCCTTTCCTGG + Intergenic
1058959002 9:109975271-109975293 ACTTGTGCCACTGACTCCCCTGG - Intronic
1059011219 9:110463136-110463158 ACCTTTTACCCTGACTCTCCAGG - Intronic
1060966814 9:127716246-127716268 ACTGCTGCCCCTGCCTCTCCCGG - Exonic
1061147799 9:128809868-128809890 ACCTGGGCCACCCTCTCTCCAGG + Exonic
1061660475 9:132126857-132126879 TCCTCTGCCCCTGGCTGTCCTGG + Intergenic
1061974199 9:134060125-134060147 GCCTCTGCCTCTGTCTCTGCTGG - Intronic
1062007538 9:134248580-134248602 ACTTGTGCCCCTTTTTCTACTGG - Intergenic
1062048997 9:134437633-134437655 TCCTGAGCCCCTCTCTCTCCAGG - Intronic
1062109189 9:134772814-134772836 ACCTGACCTCCTTTCTCTCCTGG - Exonic
1203781407 EBV:102978-103000 CCCTGTGCAGCTGTCTCCCCGGG - Intergenic
1186099853 X:6144562-6144584 ATCTGTTTCCCTGTCTCTTCCGG + Intronic
1186485639 X:9932498-9932520 GTCTGTGGCCCTGTATCTCCTGG - Exonic
1187738691 X:22331177-22331199 ACCTGTGCCACTATTACTCCTGG - Intergenic
1189753960 X:44252094-44252116 TGCTGTGCTCCTGTTTCTCCGGG - Intronic
1190221320 X:48514218-48514240 ACCCCTGCCCCTTTCTCCCCAGG + Exonic
1191877700 X:65812960-65812982 CCCTGTGTTCCTGTCACTCCAGG + Intergenic
1192510030 X:71716121-71716143 ACCTCTGGCCCTGTCGCTTCTGG - Intronic
1192516667 X:71765432-71765454 ACCTCTGGCCCTGTCGCTTCTGG + Intronic
1193358897 X:80556621-80556643 ACCTGAGGCCCTTTGTCTCCTGG - Intergenic
1194607095 X:95994256-95994278 ACATTTGCCACTGTCTCTTCTGG - Intergenic
1195756180 X:108201132-108201154 ACCTGTGCCACTGGCTCCACTGG + Intronic
1195853726 X:109309001-109309023 CCCTCTGGCCCTGTTTCTCCAGG - Intergenic
1198200948 X:134418160-134418182 ACCTCTGCTTCTGTCTCACCCGG - Intronic
1200104501 X:153704895-153704917 ACCTGTTTGCCTGTCTCTCCTGG - Intronic
1201558142 Y:15286392-15286414 AACTGTATCCCTGCCTCTCCAGG + Intergenic