ID: 1157572897

View in Genome Browser
Species Human (GRCh38)
Location 18:48724616-48724638
Sequence CCTTCCCTACAGCTGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 296}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157572888_1157572897 0 Left 1157572888 18:48724593-48724615 CCTCCCTTGATCCTCTTCCCTGA 0: 1
1: 1
2: 2
3: 28
4: 372
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572886_1157572897 25 Left 1157572886 18:48724568-48724590 CCTTACTATTCATGGCCTCATTC 0: 1
1: 0
2: 1
3: 4
4: 129
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572883_1157572897 30 Left 1157572883 18:48724563-48724585 CCACCCCTTACTATTCATGGCCT 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572884_1157572897 27 Left 1157572884 18:48724566-48724588 CCCCTTACTATTCATGGCCTCAT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572890_1157572897 -4 Left 1157572890 18:48724597-48724619 CCTTGATCCTCTTCCCTGACCTT 0: 1
1: 0
2: 2
3: 37
4: 419
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572887_1157572897 10 Left 1157572887 18:48724583-48724605 CCTCATTCATCCTCCCTTGATCC 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572885_1157572897 26 Left 1157572885 18:48724567-48724589 CCCTTACTATTCATGGCCTCATT 0: 1
1: 0
2: 0
3: 10
4: 194
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296
1157572889_1157572897 -3 Left 1157572889 18:48724596-48724618 CCCTTGATCCTCTTCCCTGACCT 0: 1
1: 0
2: 3
3: 22
4: 367
Right 1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157572897 Original CRISPR CCTTCCCTACAGCTGCTGGG CGG Intronic
900427806 1:2588408-2588430 GCTTCCCCAGAGCTGCTGGGAGG - Exonic
900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG + Intergenic
901028162 1:6290188-6290210 TCTTCCCTCCAGCTCCTGGTAGG + Intronic
901122803 1:6908783-6908805 CCTCCCCTGCAGCTGCTCAGTGG + Intronic
901662996 1:10810433-10810455 CCTTCCCACCAGCTGCCCGGAGG + Intergenic
901931802 1:12600708-12600730 CCTCCCCTCCAGCTGCGGGCAGG - Intronic
901988056 1:13091670-13091692 CCTTCCCAGCAGCCCCTGGGTGG - Intergenic
901993756 1:13135097-13135119 CCTTCCCAGCAGCCCCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905548360 1:38817624-38817646 CCTTCCCTACATCAGAGGGGAGG - Intergenic
905961905 1:42050086-42050108 CTTGCCCTACAGCTTCTGGCTGG + Intergenic
906202807 1:43970954-43970976 TCTTCCCTGCAGCTGCTGCGTGG + Exonic
906258026 1:44365544-44365566 CCTGGGCTACTGCTGCTGGGGGG + Intergenic
906772142 1:48494717-48494739 CCTTCCCTACTGCTCTTGGGTGG + Intergenic
908535545 1:65073191-65073213 CCTTCCTCCCAGCTGCTGGCTGG + Intergenic
908814245 1:68015064-68015086 CCTTCACTAGACCTGATGGGAGG + Intergenic
908901322 1:68959690-68959712 CCATCGCAACAGCTTCTGGGTGG + Intergenic
909056285 1:70824975-70824997 CCTTCTCTACTGCTGTTGGTGGG + Intergenic
914918013 1:151830222-151830244 CCTTCTCTGCTGCTGCTGCGTGG + Intronic
915253770 1:154609597-154609619 CCTTCCCCACAGCAGGTAGGGGG + Intronic
916045709 1:160998661-160998683 CCTTTCCTACCACTGCTGAGTGG - Exonic
916260531 1:162837546-162837568 ACTTCCCTACTGCTGCCTGGAGG + Intronic
916995770 1:170298724-170298746 CCTTCCCTACATCTGACGGATGG + Intergenic
921147831 1:212376529-212376551 CCTTCCTCAGAGCTGCTGTGGGG + Intronic
922702099 1:227767223-227767245 CCCTCCCTGCAGCTGCCGAGTGG - Intronic
922745613 1:228041797-228041819 CCTTCCCTATCTCTGGTGGGAGG - Intronic
922996092 1:229962726-229962748 CCTTCCCTCCAGCCTGTGGGTGG - Intergenic
924583896 1:245345236-245345258 CCTTCACTCCAGCTGCGGGTAGG - Intronic
1062899715 10:1133853-1133875 TCTTCCCCAGAGCTTCTGGGTGG - Intergenic
1063238301 10:4141950-4141972 CAGTGCCTAAAGCTGCTGGGGGG - Intergenic
1063535243 10:6876753-6876775 CCTTCCCCCCGGCTGCTGGCTGG - Intergenic
1070307543 10:75248568-75248590 CCTGTCCCCCAGCTGCTGGGGGG + Intergenic
1070570302 10:77636258-77636280 CCTTCCCCACAGCCACTGGCTGG - Intronic
1070992980 10:80748991-80749013 CCCTACCTACAGCTGATGGAAGG - Intergenic
1071504114 10:86222540-86222562 CCTGCTCCCCAGCTGCTGGGTGG - Intronic
1071826238 10:89329101-89329123 CCTTTCCTAGAGATGCTTGGTGG - Intronic
1073571238 10:104582743-104582765 CCTCCCCTGCACCTGCTGTGAGG + Intergenic
1074112317 10:110431244-110431266 CCTCCTCTACTGCTGGTGGGAGG - Intergenic
1074311069 10:112323811-112323833 CCTTCCCTAGAGCTTCTGGAGGG + Intergenic
1074530117 10:114291276-114291298 CCTTCTCTGTAGTTGCTGGGAGG - Exonic
1075170136 10:120105677-120105699 CCTTCTCTTCATCTGCAGGGCGG - Intergenic
1076542200 10:131221223-131221245 CCCTCCCTGCTGCTGCGGGGTGG + Intronic
1077102522 11:828470-828492 CCTTCCCACCTGCTGCAGGGAGG + Intronic
1077539519 11:3139947-3139969 TCTTCCCTGCAGCTCCTGGCAGG + Intronic
1078329479 11:10407970-10407992 CCTCACCTACAGCTCCTTGGAGG - Intronic
1080796163 11:35565586-35565608 CCTTCCCTGAAGATGATGGGAGG + Intergenic
1081789885 11:45775064-45775086 CCATCCTTGCACCTGCTGGGTGG - Intergenic
1082739160 11:56890970-56890992 TCTTTCCCCCAGCTGCTGGGTGG + Intergenic
1083027261 11:59561176-59561198 CCTTCTCTATAGGTGCTTGGAGG - Intergenic
1083400389 11:62419242-62419264 CCTGCTCTGGAGCTGCTGGGAGG + Intronic
1084409799 11:69000149-69000171 CCCTGCCTCCAGCTCCTGGGAGG + Intergenic
1085341138 11:75732352-75732374 CCTTCCCTCCAGCTTCTAGTTGG - Intronic
1085477607 11:76797890-76797912 CCTCCCCTACCCCTGCTGGCCGG + Exonic
1085526465 11:77166971-77166993 CCTTCGCAGCAGCTGCTGAGTGG - Intronic
1086968398 11:93053980-93054002 CCTTCCCCATAGCTCCTGTGTGG - Intergenic
1089368169 11:117933842-117933864 CCTCCCTTAGAGCTGCTGAGAGG - Intergenic
1089630948 11:119783767-119783789 CCCTCCCAACAGCACCTGGGAGG - Intergenic
1089661702 11:119990317-119990339 CCATCCCTGGAGCTGCAGGGTGG + Intergenic
1090241146 11:125182764-125182786 CCTTCTCTGTAGCTGCTGGCAGG - Intronic
1090412730 11:126520251-126520273 CCTTCACAACAGCTGCTAAGGGG + Intronic
1090556680 11:127883782-127883804 CTTTCCCTCCAGCTTCTGGTCGG - Intergenic
1091098354 11:132845513-132845535 CCCTCCCCATAGCTACTGGGAGG - Intronic
1091121002 11:133057486-133057508 CCTTGCCTTCTGCTTCTGGGTGG + Intronic
1091289674 11:134430959-134430981 CTTTCCCTGCATGTGCTGGGTGG - Intergenic
1092695920 12:11171317-11171339 CCCTCGCTACAGACGCTGGGCGG + Intronic
1093885542 12:24455785-24455807 CCCTCCTTCCAGCTGCCGGGAGG + Intergenic
1094668816 12:32548766-32548788 CCTGCCCTACTGCTGCTTTGTGG + Intronic
1094829570 12:34293878-34293900 CCTTCCCAACAGCCCCTGCGCGG - Intergenic
1094835941 12:34322121-34322143 CCTTCCCAGCAGCTGCTGCATGG - Intergenic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1096523492 12:52197272-52197294 CTTTCCCTGCACCTGCTGAGTGG + Intergenic
1100461037 12:94799414-94799436 CCTTACCTCCAGATACTGGGTGG + Intergenic
1101882264 12:108633660-108633682 CCTGCCTTATAGCTGCTGGCAGG - Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1102663511 12:114549818-114549840 CCTTCCAAACATCTCCTGGGAGG - Intergenic
1102756777 12:115347978-115348000 CCTACCCTCCACCTGCTGGGGGG - Intergenic
1103440493 12:120959266-120959288 CTTTGCCTTCAGTTGCTGGGAGG + Intergenic
1103859241 12:123998781-123998803 ACTGCCCAACAGATGCTGGGTGG + Intronic
1104640845 12:130465883-130465905 ACCTCCCTGCAGGTGCTGGGTGG - Intronic
1104899339 12:132179927-132179949 CATTCCCTACAGCAGGTGGTGGG - Intergenic
1105277313 13:18943642-18943664 CCTTCCCTGCAGCCCCTGCGTGG - Intergenic
1105431359 13:20340324-20340346 CCTGCCCTCCAGCCCCTGGGAGG + Intergenic
1106316237 13:28596490-28596512 CCTTCCCTACTGCAGCTCTGCGG + Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1112605149 13:100897215-100897237 CATGCCCTTCAGCTGCTGTGAGG + Intergenic
1113064520 13:106359909-106359931 CCTACCCTACAGCAGCTTGTGGG - Intergenic
1113941943 13:114023066-114023088 CAGGCCCTACGGCTGCTGGGAGG - Intronic
1114041749 14:18685164-18685186 CCCTCCCTACAGCAGCAGGTGGG + Intergenic
1114065270 14:19054494-19054516 CCTGCCCTCCTGCTGCTGAGAGG + Intergenic
1114096992 14:19345508-19345530 CCTGCCCTCCTGCTGCTGAGAGG - Intergenic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1114550999 14:23532872-23532894 CCTTCCATTCAGCTTCCGGGAGG + Exonic
1115851600 14:37594351-37594373 CCTTCTCTAAAACCGCTGGGTGG - Intronic
1118009203 14:61592287-61592309 ACTTCCCTGCAGCCTCTGGGAGG - Intronic
1118235741 14:64003767-64003789 CCTACCCTAATCCTGCTGGGAGG - Intronic
1119678653 14:76575431-76575453 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1120108395 14:80523106-80523128 CCTTCCCTACACCAGCAGTGTGG + Intronic
1120710211 14:87785697-87785719 CCTTCCCTAGGGCTGGGGGGTGG - Intergenic
1121605277 14:95235976-95235998 CCTTCTCTACAGCAGCTTGGTGG - Intronic
1121608812 14:95261685-95261707 CCTTCCCGACAGCAGTTGTGTGG - Intronic
1126110735 15:45173400-45173422 CCTTCCCCACAGCTGTGGGATGG - Intronic
1127754438 15:62077329-62077351 CCTTCCCTAAAGGTGCTGCTAGG - Intergenic
1128979570 15:72176339-72176361 CCTTCCCCACAGCTGGGGTGGGG + Intronic
1129110132 15:73332359-73332381 CCTGCCCTGGAGCTGCTGGTGGG + Intronic
1130097379 15:80866081-80866103 CCTCCCCTACAGCTGATTGGTGG + Intronic
1130678300 15:85973834-85973856 CCTGCCTTAGAGCTGGTGGGAGG + Intergenic
1131265096 15:90911010-90911032 CCATCCCAAGAGCTGCTGGATGG + Intronic
1132643612 16:988951-988973 CCTCCCAGGCAGCTGCTGGGAGG - Intergenic
1133556009 16:6907179-6907201 CCTGCCCTACAGATGCCAGGAGG - Intronic
1135074976 16:19385283-19385305 CTTTGCCTCCAGCTCCTGGGGGG + Intergenic
1136576418 16:31127892-31127914 ACTTTCCTAAGGCTGCTGGGAGG + Intronic
1137780763 16:51096016-51096038 CCTTCCCCCCTGCTGCGGGGTGG + Intergenic
1137965506 16:52928607-52928629 CTTTGCCTTCAGCTTCTGGGAGG - Intergenic
1141763677 16:86045094-86045116 CCTTCCCTAGAGCCTCTGGAGGG + Intergenic
1141773890 16:86109498-86109520 CCTCCCCTACAGCCTCTGGAGGG + Intergenic
1142076880 16:88123658-88123680 CCATCCCTACATCTACTGGGGGG - Intergenic
1142886058 17:2912624-2912646 CCATCCCTACTGCTGGAGGGAGG + Intronic
1144095605 17:11897945-11897967 CCTTCCCTAGAGCCTCTGGAGGG - Intronic
1144748867 17:17634442-17634464 CCCTCCCTACAGTTGCTGCCTGG - Intergenic
1144752257 17:17657239-17657261 CCTTCCCTAGAGCCTCTGGAGGG - Intergenic
1144960130 17:19040097-19040119 GCTGGCCTACAGCTGCTGAGAGG - Intronic
1144975030 17:19134427-19134449 GCTGGCCTACAGCTGCTGAGAGG + Intronic
1146952263 17:36915019-36915041 CCTACCCTACAGCTGCTGAGAGG - Intergenic
1147419044 17:40312923-40312945 CCTTCCCTACTGCAGCAAGGAGG + Intronic
1147421175 17:40322837-40322859 CCTTCCCTCCAGCTCCAGGTAGG + Intronic
1148105299 17:45115476-45115498 CCGGCCCTTCAGCTGCTGTGGGG + Exonic
1148721146 17:49754211-49754233 CCTGCCCCACAGCTGCAGGCTGG - Intronic
1149206845 17:54257733-54257755 CTTTGCCTTCAGCTCCTGGGAGG + Intergenic
1149325399 17:55524949-55524971 ACTTCCATAGAGTTGCTGGGAGG - Intergenic
1150280818 17:63928871-63928893 CCTTCCCAAGCTCTGCTGGGAGG + Exonic
1151380307 17:73721024-73721046 CCTTCCCTTCAGCAACTGTGGGG - Intergenic
1151436224 17:74099493-74099515 CCTTCTCTCCACCTGCTTGGTGG + Intergenic
1151826813 17:76528404-76528426 CCCCCCCTGGAGCTGCTGGGAGG - Exonic
1152784357 17:82240294-82240316 TTCTCCCTTCAGCTGCTGGGTGG - Intronic
1153104518 18:1511385-1511407 GCATCCCTGCTGCTGCTGGGCGG + Intergenic
1155358495 18:24977419-24977441 GCATCCCTACAGAAGCTGGGTGG - Intergenic
1156459679 18:37314713-37314735 CCTCCCCTGCAGCTTGTGGGGGG + Intronic
1156811271 18:41255417-41255439 CAATCACTAAAGCTGCTGGGAGG - Intergenic
1157304843 18:46509389-46509411 CCTTCAGGACAGCAGCTGGGAGG - Intronic
1157571348 18:48714380-48714402 CCTTCCCTTCATATGGTGGGGGG - Intronic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1157734913 18:50038903-50038925 CCTTCACTCCAACTGCTGGTGGG - Intronic
1158841386 18:61391991-61392013 CTTTCCCCACAGCTGCAGTGTGG - Intronic
1159386757 18:67735746-67735768 CCTCCCCAACAGCTGCTGGGAGG + Intergenic
1160173037 18:76570201-76570223 CCTTGGCTGCAGCTGCTGGCCGG - Intergenic
1161246127 19:3253150-3253172 CCTGCCCTCCAGCTTCTGGTTGG - Intronic
1161542124 19:4858331-4858353 CCTGCCCCTCAGCAGCTGGGTGG - Intronic
1162057081 19:8071297-8071319 CCTGCCCTACGGCTACTGAGTGG + Intronic
1162609711 19:11739356-11739378 CCCTCCCTCCTGCTGCAGGGTGG - Intergenic
1162689186 19:12414508-12414530 CCTTCCCTCCTGCTGCAGGGTGG - Intronic
1163411792 19:17159463-17159485 CCTTCCCTACAGCCTCAGCGAGG + Exonic
1164134891 19:22405783-22405805 CCATCTCTACAGCTCCTGGCAGG + Intronic
1164640545 19:29822161-29822183 CCTTCCCTGCAGCTGGAGTGAGG + Intronic
1165573034 19:36791513-36791535 CCGTCTCTCCAGCTTCTGGGAGG - Intergenic
1165632355 19:37312531-37312553 CCGTCTCTCCAGCTTCTGGGAGG - Intergenic
1167416337 19:49375012-49375034 CCACCCCTACAGCTGCCGAGAGG - Exonic
1167661151 19:50796793-50796815 CATTCCCTAGAGGAGCTGGGTGG + Intergenic
1167718587 19:51161196-51161218 CCTTCCCTCCAGGTGCTCAGGGG - Intergenic
926753384 2:16217439-16217461 ACTTCCCTACTGCTGCAGTGAGG + Intergenic
927785189 2:25969141-25969163 CATTCCTTACAGCTCCTGGGAGG + Intronic
928093112 2:28388345-28388367 CCTTCCCTCTACCTGCTGGATGG + Intergenic
928437114 2:31261817-31261839 CCTTGCCTGCAGATTCTGGGCGG - Intronic
928970009 2:37018127-37018149 CCTTTCCTTCTGTTGCTGGGAGG - Intronic
933767112 2:85717489-85717511 GCTTCCCTTCAGCTCATGGGAGG + Intergenic
934964561 2:98709152-98709174 CCTTCCCTAGAGCTGTAGTGTGG + Intronic
935208805 2:100920905-100920927 CCTTCGCTTCAGCTCCTAGGAGG - Intronic
936076463 2:109404681-109404703 CCTTCCGCAAAGGTGCTGGGAGG - Intronic
936288775 2:111201530-111201552 TCTTCCCTCCAGCAGCTGGGAGG - Intergenic
937953340 2:127405162-127405184 CCTTGCCTGCAGCTCCTGAGTGG - Intergenic
938147429 2:128848442-128848464 GCTTCCCAGCAGCTGCTGTGGGG + Intergenic
942171134 2:173290743-173290765 CCTGCTCTGCAGCTGCTGAGTGG - Intergenic
942851625 2:180494532-180494554 CCTTCCCTTCCCCAGCTGGGTGG + Intergenic
942905389 2:181174154-181174176 CCTTCCCTAGTGATGCTGGTAGG - Intergenic
943574216 2:189612143-189612165 CCTGGCCCCCAGCTGCTGGGAGG - Intergenic
945054588 2:205857407-205857429 CCTTCCCTAGAGCAGATGGCAGG + Intergenic
945190761 2:207185083-207185105 TCTACCCTACCGCTGCTGAGGGG - Intergenic
946031494 2:216708574-216708596 CTTTCCCACCAGCTCCTGGGAGG + Intergenic
946526875 2:220530224-220530246 GCTTCCCTGCAGCCTCTGGGGGG + Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
948048909 2:234964706-234964728 CCTTCCCAAGAGCACCTGGGAGG + Intronic
948624892 2:239262823-239262845 CTTTTCCAAGAGCTGCTGGGTGG - Intronic
948892983 2:240916132-240916154 CCTTCCCCACGGCTCCAGGGTGG - Intergenic
1169019619 20:2319764-2319786 CATTCCCTACAGCTGATGGTTGG + Intronic
1169424433 20:5485235-5485257 CCTGCCCAGCAGCTGCAGGGAGG - Intergenic
1171283062 20:23917526-23917548 CCATGCCTACAGCTGCAGTGAGG - Intergenic
1171885996 20:30652826-30652848 CCTTGCCTCCATCTGCAGGGAGG - Intergenic
1171886190 20:30653956-30653978 CCTTGCCTCCATCTGCAGGGAGG - Intergenic
1172066790 20:32227077-32227099 TCTTCCCTCCAGCTGGAGGGGGG - Intronic
1172151954 20:32796929-32796951 CCTTCCCAACAGCACCTGTGTGG + Intronic
1172153535 20:32807815-32807837 CCTTCCCAGCAGCTTCTGGCGGG - Exonic
1172591117 20:36118840-36118862 TCCTCCTTACAGCTGCTGTGAGG - Intronic
1174122887 20:48280197-48280219 CCCTCCCTCCATCTGCTGGCTGG - Intergenic
1175181246 20:57149123-57149145 CCTTCCCAGAAGTTGCTGGGAGG + Intergenic
1175366638 20:58460711-58460733 CCTTCCCTACAGCTGCCAGGAGG + Exonic
1176009831 20:62887075-62887097 CCTCTCCAGCAGCTGCTGGGTGG + Intronic
1176937059 21:14879665-14879687 TCTTCCTTACAGCTGTTGAGAGG - Intergenic
1178940690 21:36902540-36902562 CCTGCTCCACAGCTGCAGGGAGG + Intronic
1181423042 22:22815039-22815061 CCTGACCTACAGCTGCTCAGAGG - Intronic
1181435555 22:22908374-22908396 CCTTCACCAGAGCTGCTGGGTGG + Intergenic
1181512432 22:23394900-23394922 CCTTCTCTGCAGCTCCTGGCAGG - Intergenic
1182313598 22:29427140-29427162 CCTTCACCAGAGCTGCTGGGTGG - Intergenic
1182511965 22:30826318-30826340 CCTTCCCTGCACCTGCAGAGTGG + Intronic
1182698506 22:32212200-32212222 CCTTCCTCACAGCTGCAGTGGGG + Intergenic
1183265572 22:36823206-36823228 CCTCCCCTCCACCAGCTGGGAGG - Intergenic
1183342767 22:37290929-37290951 CCATCCCCCCAGCTGCTGGGAGG - Intronic
1183868064 22:40719955-40719977 CCTTCCCTACAGGTTTTGGGGGG - Intergenic
1184498930 22:44860342-44860364 CCTTCCCTAGAGCCTCTGGAAGG - Intronic
1184847854 22:47100130-47100152 CCATCCCTGCAGCTGCAGGCCGG + Intronic
1185269919 22:49924731-49924753 CTCTCCCTCCAGCTCCTGGGTGG + Intronic
1185289053 22:50014933-50014955 CCTTCCCCAGAGCGGCTCGGAGG + Intergenic
950667759 3:14507512-14507534 CCCTTCCTAAACCTGCTGGGTGG + Intronic
950811075 3:15650639-15650661 TCTTCTCTAGAGCTGCTGAGAGG - Intergenic
952599106 3:35057357-35057379 CCTTGCCTTCGGCTCCTGGGAGG + Intergenic
953789523 3:45936774-45936796 TCTTCCCTACAGCTGCTCCAGGG - Intronic
954733886 3:52688746-52688768 CCTTGCCAAAAGCTGCTGAGGGG - Intronic
954971269 3:54653564-54653586 CTCTCCCTTCAGCTGCAGGGAGG - Intronic
955638162 3:61053106-61053128 CCTTCCCTGCAGTGGATGGGAGG - Intronic
957041664 3:75340726-75340748 CCTCCCCTTCAGCTCCTGTGAGG - Intergenic
960259297 3:115547361-115547383 CCTTCCATACAGCTGCTACATGG - Intergenic
960991676 3:123315482-123315504 CCTTCTCTGCAGCGGCTTGGGGG - Intronic
961046377 3:123711519-123711541 CCTCCCCTTCAGCTCCTGTGAGG - Intronic
963055497 3:141182995-141183017 CCTTCCCTAGAAGGGCTGGGTGG - Intergenic
964669098 3:159205635-159205657 CTTTGCCTTCAGCTGCTGTGAGG - Intronic
965447225 3:168789930-168789952 CCCTCGCTACAGCTGCTGTGGGG - Intergenic
966874833 3:184315751-184315773 CTTTCCCAACAGGTGCTGGGGGG + Exonic
967882904 3:194314300-194314322 CATTCCCTACAGCCCCAGGGAGG - Intergenic
968605293 4:1532481-1532503 CCCTACCTACAGATGCTGGTGGG - Intergenic
968660571 4:1797173-1797195 CCCTTCCTAGGGCTGCTGGGGGG + Intronic
968913575 4:3487535-3487557 CCTTCCCTCCTGCTCCTGGTGGG - Intronic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
970346626 4:15159020-15159042 CCTTTTCTCTAGCTGCTGGGAGG - Intergenic
970539690 4:17064965-17064987 CCTTCTCCACAGCTCGTGGGAGG - Intergenic
972287585 4:37663592-37663614 GCTTCCTTACAGATGCTGCGAGG - Intronic
975148733 4:70998056-70998078 ACTTCCCTGCAGCTGTTGTGAGG - Exonic
975738125 4:77401557-77401579 CTTTCCCAGCAGCTGCTTGGAGG - Intronic
978382535 4:108144657-108144679 CCTGCCCTCCAGCAGCTGTGTGG - Intronic
982221111 4:153125997-153126019 CCTTCCCCACACCTGCTGCCTGG - Intergenic
983071898 4:163277821-163277843 CCTTCCAAACAGCTGCGAGGTGG - Intergenic
983637761 4:169915575-169915597 CCTTCCCTACAAGTGCCTGGTGG + Intergenic
984923139 4:184783359-184783381 TCCTCCCTACAGCTGCCTGGGGG + Intronic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
985101938 4:186467090-186467112 TCATTCCCACAGCTGCTGGGAGG + Intronic
987419461 5:17701690-17701712 AGTTCCTTACAGATGCTGGGTGG + Intergenic
989213481 5:38880357-38880379 CCTGCCCCACAGCTGCAAGGTGG - Intronic
990441500 5:55850609-55850631 CCATCCCAACAGCAGATGGGGGG - Intergenic
991292264 5:65044612-65044634 GCTTCCCCACAGCTGCAGGTGGG + Intergenic
991925156 5:71698204-71698226 CCTGGCCTAGAGCTGCTGAGTGG + Intergenic
992970965 5:82057386-82057408 CCTTCCCTAAAGCCTCTGGTGGG - Intronic
993845075 5:92931230-92931252 TCTTCCCTAGAGCTTCTGGAAGG + Intergenic
997199881 5:132003492-132003514 CCTCCCCTGCCGCTCCTGGGAGG - Intronic
997230522 5:132239130-132239152 CCTGCCCTGCAGCTTCTGGTTGG + Intronic
997715402 5:136038859-136038881 TCTTCCCTACAGCCTCTGTGAGG + Intronic
999098603 5:149004051-149004073 GCTTCCCTGGAGCTTCTGGGAGG + Intronic
1000714603 5:164625033-164625055 CTTACACTACAGTTGCTGGGAGG - Intergenic
1001209008 5:169792944-169792966 ACTTGCCTGCAGCTGCTGGCTGG - Intronic
1006979839 6:38138439-38138461 AGTTCCCTCCAACTGCTGGGAGG + Intronic
1007290459 6:40782354-40782376 CTTTGCCTTCAGCTACTGGGAGG + Intergenic
1007599921 6:43075416-43075438 CCTTCCCCCAAGCAGCTGGGAGG - Intergenic
1009863454 6:69365848-69365870 CCTCCCTTACAGCTGTTGTGAGG + Intronic
1011572159 6:88749863-88749885 TCTTCCCTACAGGTGTTGGAGGG - Intronic
1016738612 6:147507076-147507098 CGTTCCCTACAGTCGCAGGGGGG - Intergenic
1016918301 6:149265596-149265618 CTTTCAGTACAGATGCTGGGTGG - Intronic
1017841138 6:158224016-158224038 CCTTCTGCAGAGCTGCTGGGTGG - Intergenic
1018396114 6:163379223-163379245 CCTTCCTCACAGCTGCTAAGAGG + Intergenic
1018641430 6:165907721-165907743 CTTTCCCCACTGCTGCAGGGAGG - Intronic
1018684344 6:166291962-166291984 CCTTGGTTCCAGCTGCTGGGAGG + Intergenic
1019442905 7:1056371-1056393 CCCTCACTGCGGCTGCTGGGCGG + Intronic
1019488176 7:1298991-1299013 CGTGCTCGACAGCTGCTGGGAGG - Intergenic
1019612817 7:1945577-1945599 CCTTCCCTTCATCTCCAGGGTGG - Intronic
1020092881 7:5351167-5351189 CCGTCCCTACTCCTTCTGGGTGG + Intronic
1023819086 7:43970449-43970471 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023819135 7:43970713-43970735 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1024965929 7:55021862-55021884 ACTTTCCCACAGCTGGTGGGAGG + Intronic
1025482808 7:61005335-61005357 CCTTACCTGTAGCTGCTGGGTGG - Intergenic
1026356204 7:69559693-69559715 CCTTCCCTACATCTCCTGTTAGG + Intergenic
1029744139 7:102507408-102507430 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029744186 7:102507676-102507698 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762130 7:102606571-102606593 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762177 7:102606838-102606860 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1030287021 7:107837364-107837386 CATCCCCTAAAGGTGCTGGGGGG + Intergenic
1032021236 7:128408152-128408174 CTATCCCCACAGCTGCTAGGTGG - Intronic
1034560906 7:151878421-151878443 CCTTCCTTTCAGCTGCTTGCCGG + Intergenic
1037971726 8:23176767-23176789 TCTTGCCTATAGCTCCTGGGAGG - Intergenic
1041381616 8:57258921-57258943 TCCTTCCTGCAGCTGCTGGGCGG - Intergenic
1041437557 8:57859196-57859218 CCTGACCTGCAGCTGCTGGCAGG + Intergenic
1041795859 8:61747239-61747261 CCTTCTCTGCAGCTGCAGGTAGG - Intergenic
1041844317 8:62310519-62310541 CCTACCCTACAGTTGCTGCTAGG + Intronic
1042013840 8:64284498-64284520 CCTTCCCTCCAGGTACAGGGTGG - Intergenic
1043122400 8:76343895-76343917 TCTGCCCTGCAGCTGGTGGGAGG - Intergenic
1044523599 8:93226805-93226827 GCTTCCCTACAAGTGCTGTGAGG + Intergenic
1045934623 8:107664484-107664506 CCTTCCCTCAATTTGCTGGGAGG - Intergenic
1047173854 8:122521858-122521880 TGTTTCCTTCAGCTGCTGGGTGG + Intergenic
1048459961 8:134613555-134613577 CCTTCCCCACGGCTGCTTTGGGG + Intronic
1048781064 8:138001667-138001689 CCATCCCTACACCTTCTGGTAGG - Intergenic
1049353257 8:142175453-142175475 GCATCCCTGCAGGTGCTGGGTGG - Intergenic
1052234910 9:26199540-26199562 TCTTCCCTGCATCTGCTGTGTGG + Intergenic
1053094220 9:35310468-35310490 CCATACCTACTGCTGCTGGTGGG - Exonic
1053293450 9:36897177-36897199 CCTTACCCACAGCTGCTGCCTGG - Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056781557 9:89554812-89554834 GCCTCCCTGCAGCTTCTGGGTGG - Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1057262531 9:93593175-93593197 CCTTCCCTGGAGTTGTTGGGAGG + Intronic
1059646926 9:116276888-116276910 CCTCCCCACCAGTTGCTGGGAGG + Intronic
1060147874 9:121268027-121268049 CCCTCCCGTCGGCTGCTGGGCGG - Intronic
1061251875 9:129431229-129431251 CCTCCCCCACAGCTGCAGAGGGG - Intergenic
1061387502 9:130299154-130299176 CCCGCCCCACAGCTGATGGGTGG - Intronic
1061424055 9:130488360-130488382 CCTGCCCTGCAGCTGCTGTCTGG - Intronic
1061669741 9:132182178-132182200 CCTTCCCCAGAGCTGGTGCGTGG - Intronic
1062151269 9:135020404-135020426 CCTCCCCTAGAGCTTCTGGAGGG + Intergenic
1062289830 9:135789514-135789536 CCTTCCTCACAGCTGCCGTGGGG + Intronic
1062352935 9:136148041-136148063 CCATCCCTCCACCTGCTGTGTGG - Intergenic
1062568221 9:137172636-137172658 CCCTCCCCACTGCTTCTGGGAGG + Intergenic
1062572736 9:137193068-137193090 CCTGCTCTAGAGCTGCTTGGTGG - Intronic
1185445191 X:254158-254180 CCTCCACTACAGCTCCTGGAGGG - Intergenic
1185586429 X:1244838-1244860 CATCGCCGACAGCTGCTGGGGGG + Intergenic
1185677088 X:1857897-1857919 CCTCCCCTAGAGCTTCTGGAGGG - Intergenic
1185792693 X:2939313-2939335 CCTCCCCTAGAGCTTCTGGCGGG + Intronic
1185870347 X:3659491-3659513 CCTGCCCCTCAGCAGCTGGGTGG + Intronic
1187015858 X:15328253-15328275 TCTACCCTACAGTTGTTGGGAGG + Intronic
1190944398 X:55076790-55076812 CATTTCCTACTGCTGCTGTGTGG + Intronic
1190945642 X:55090723-55090745 CATTTCCTACTGCTGCTGTGTGG + Intronic
1198741340 X:139846556-139846578 CTTTCCCTATAGCAACTGGGTGG - Intronic
1199770291 X:150970884-150970906 CATCCCCTACAGCAGCAGGGAGG + Intergenic
1200041659 X:153375308-153375330 CCTTCCCTAGAGCCTCTGGGGGG + Intergenic
1200067862 X:153513134-153513156 CCTTCCCTAGAGCTTCTGGGGGG - Intergenic
1200123137 X:153800661-153800683 GCCTCCCTCTAGCTGCTGGGGGG - Intergenic