ID: 1157573686

View in Genome Browser
Species Human (GRCh38)
Location 18:48730252-48730274
Sequence GAGGGGCCCCCGCAGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157573677_1157573686 5 Left 1157573677 18:48730224-48730246 CCCGAAGTGTGAGGGGCCTCCGC 0: 1
1: 0
2: 1
3: 18
4: 102
Right 1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG 0: 1
1: 0
2: 5
3: 27
4: 187
1157573676_1157573686 6 Left 1157573676 18:48730223-48730245 CCCCGAAGTGTGAGGGGCCTCCG 0: 1
1: 0
2: 0
3: 26
4: 74
Right 1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG 0: 1
1: 0
2: 5
3: 27
4: 187
1157573678_1157573686 4 Left 1157573678 18:48730225-48730247 CCGAAGTGTGAGGGGCCTCCGCG 0: 1
1: 0
2: 1
3: 6
4: 46
Right 1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG 0: 1
1: 0
2: 5
3: 27
4: 187
1157573671_1157573686 23 Left 1157573671 18:48730206-48730228 CCTGTGGTGTGAGGAGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG 0: 1
1: 0
2: 5
3: 27
4: 187
1157573675_1157573686 7 Left 1157573675 18:48730222-48730244 CCCCCGAAGTGTGAGGGGCCTCC 0: 1
1: 0
2: 1
3: 7
4: 85
Right 1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG 0: 1
1: 0
2: 5
3: 27
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157573686 Original CRISPR GAGGGGCCCCCGCAGTGTGA GGG Intronic
900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG + Intronic
900610044 1:3540832-3540854 GAGTGGACTCCCCAGTGTGATGG - Intronic
900743296 1:4343526-4343548 GAGGGGCTACTGCAGTGGGAGGG - Intergenic
902667805 1:17951846-17951868 GAGGGGTGCCCGCAGTGGGAGGG + Intergenic
903293026 1:22326597-22326619 AAGGGGACCCAGAAGTGTGAGGG - Intergenic
904800358 1:33088258-33088280 GAAGGGCCCCCTCAGTCTGCTGG + Intronic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
908234576 1:62137511-62137533 GAGGGGGCACAGCAGTCTGAGGG + Intronic
908301045 1:62761436-62761458 GAGGGGCTCCCACAGTGTAGCGG - Intergenic
909958320 1:81803281-81803303 GAAGCGCCCCAGCAGTGTGGAGG + Intronic
913336002 1:117709427-117709449 GAGGGTCCCACCCAGTGTGCTGG - Intergenic
913376440 1:118157607-118157629 AAGGGGCCACCACAGTATGAAGG - Intronic
915161183 1:153922243-153922265 GAGCGGCCCCCGCACCCTGAGGG + Intronic
915343283 1:155187674-155187696 GAGGGGCCCCGGCATGGTGCTGG + Intronic
919991075 1:202709175-202709197 GAGGGGCCACTGCAGTGGGGAGG - Intronic
920850911 1:209627341-209627363 CGGGGGCCCCCTCAGTGGGAGGG - Intronic
922282966 1:224143414-224143436 GAGGGTGCCCTGCAGTGAGATGG + Intronic
922787999 1:228292900-228292922 GAAGGGACTCCGCAGAGTGATGG - Intronic
923211369 1:231807057-231807079 GAGGGCCCCCAGCAGTGGGAAGG - Intronic
924123048 1:240822120-240822142 GAGGCCCACCCGCATTGTGAAGG - Intronic
1064855969 10:19767416-19767438 CATGGGCCACCGCAGTGTCACGG + Intronic
1065554846 10:26905469-26905491 GCGGGGCTCCCACAGTGTGGCGG - Intergenic
1069280898 10:66651879-66651901 GAGGGGCTCCCACAGTGCAACGG + Intronic
1069812962 10:71175927-71175949 GAGGTGCCCCCTCACTGGGAAGG - Intergenic
1069832048 10:71287509-71287531 GAGGGGCCTCGTCAGGGTGAGGG + Intronic
1071511997 10:86267865-86267887 GAAGGGCCTCTGCAGTTTGAGGG - Intronic
1075063442 10:119272893-119272915 GAGGGGACTCCGCAGGCTGAGGG + Intronic
1076930853 10:133530764-133530786 TAGGGGCCCCTGCGGTGTAAAGG + Intronic
1077282970 11:1753906-1753928 GAGGGGTCACAGCAGTGTCAGGG + Intronic
1079107428 11:17580430-17580452 GAGGGGTCCCTGGAGTGAGAAGG + Intronic
1079243607 11:18737802-18737824 GAGGGTCCTCCTCAGGGTGAGGG + Intronic
1079803112 11:24896211-24896233 GAGGGGCCCCCACAGTGCAGTGG - Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1085460402 11:76689857-76689879 GAAGGGCCCCAGCCGTGTGAAGG + Intergenic
1087441240 11:98185656-98185678 GAGGGGCTCCCGCAGTGCAGTGG + Intergenic
1090957833 11:131529526-131529548 GAAGGGCCACCGGAGTGTCAAGG + Intronic
1091224934 11:133951466-133951488 GAGCGGCCCCCGCAGAAGGAAGG - Intronic
1097253627 12:57655691-57655713 GAGGGGCTCCCACAGTGTAGCGG - Intergenic
1097547519 12:61023335-61023357 GAGGGGCCCCCACAGCGTATTGG - Intergenic
1100196889 12:92256496-92256518 GAGGGGCCCCTCCATTGTTAGGG + Intergenic
1101877985 12:108608060-108608082 GAGGAGCCCCAGCAGCGGGAAGG + Intergenic
1105763091 13:23531476-23531498 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1106700621 13:32224358-32224380 GAGTGGCCCCCGGGGAGTGATGG - Exonic
1106815776 13:33405285-33405307 GAGGGGCACGCGAAGTGTGGAGG - Intergenic
1106840586 13:33682031-33682053 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1108597214 13:51959945-51959967 TTGGGGCCCCCCCAGTGTGGGGG - Intronic
1108958178 13:56187442-56187464 GAGGGGCCCCCACAGTGTAGTGG - Intergenic
1109534141 13:63693981-63694003 GAGGGGCCCCCACAGTGCAGCGG + Intergenic
1112077819 13:95931874-95931896 GAGGGGCCCCCACAGTGCAGTGG + Intronic
1112402209 13:99086738-99086760 GAGGGGCCGCCGCGGCGGGACGG + Intergenic
1113501147 13:110775455-110775477 GAGGTGGCCCCGCAGAGTGCAGG - Intergenic
1114566305 14:23635723-23635745 GAGGGGCCCCCACAGTGCAGTGG - Intronic
1115533290 14:34346237-34346259 GAGGGGCTCCCACAGTGCAACGG + Intronic
1119695115 14:76707105-76707127 GAGGGGCTCCCACAGTGCAACGG + Intergenic
1121786479 14:96665277-96665299 GAGGGTCCCCAGCAGCATGAAGG + Intergenic
1122115133 14:99523724-99523746 GCAGGGCCCCCAAAGTGTGATGG + Intronic
1122424600 14:101598522-101598544 GAGTGGCCCATGCGGTGTGAAGG - Intergenic
1122434920 14:101689004-101689026 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1124072966 15:26413003-26413025 GAGGAGCTCCCTCAGTCTGAGGG + Intergenic
1126142276 15:45448362-45448384 GAGGGCGTCCAGCAGTGTGATGG + Intronic
1126191758 15:45885887-45885909 GAGGGGCCCCCACAGTGCAGCGG - Intergenic
1131091659 15:89628673-89628695 GGGGGGCCCCCTCAGTGAGGGGG + Exonic
1132486893 16:197891-197913 GGGGGGCTCCATCAGTGTGAAGG + Intronic
1132932931 16:2468002-2468024 GCGGGGTCCCCGCAGCGAGAAGG - Intergenic
1135745698 16:25014940-25014962 CAGGGGACCCCGCGGTGTGGCGG + Intronic
1139754526 16:69132236-69132258 GAGGGGCCTCCGGGGTGGGAGGG - Intronic
1143141619 17:4744600-4744622 GAGGGGCCCCAGGAGTGGGGTGG - Intronic
1145220691 17:21085937-21085959 GAGGGGCCCCCACAGTGCAGCGG + Intergenic
1147605425 17:41771497-41771519 TAGGGGCCCACCCAGTCTGAAGG - Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148079552 17:44960138-44960160 GAGGGGACCCCGGCGGGTGAGGG + Exonic
1148693201 17:49544811-49544833 GCAGGGCCCCTGCAATGTGAGGG + Intergenic
1149856902 17:60090559-60090581 GTGAGGACCCCGGAGTGTGACGG + Intergenic
1151511591 17:74564240-74564262 GAGTGGCCCCAGCACCGTGATGG - Intergenic
1152083955 17:78205901-78205923 GAGGGGCCTGAGCAGTGGGAGGG - Intronic
1152358170 17:79816522-79816544 AACGTGCCCCCGCAGAGTGAGGG + Intergenic
1154166097 18:12015515-12015537 GAGGGCCCGCCACTGTGTGAGGG + Intronic
1156629112 18:38944840-38944862 GAGGGGCTCCCGCAGTGCAGCGG + Intergenic
1157573657 18:48730162-48730184 GAAGGGCCTCCACAGTGTGAGGG + Intronic
1157573663 18:48730180-48730202 GAGGGGCCCCCGAGGTGTGAGGG + Intronic
1157573673 18:48730216-48730238 GAGGAGCCCCCGAAGTGTGAGGG + Intronic
1157573681 18:48730234-48730256 GAGGGGCCTCCGCGGTGTGAGGG + Intronic
1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG + Intronic
1157573701 18:48730288-48730310 GAGGGGCCCCTGAGGTGTGAGGG + Intronic
1157573708 18:48730306-48730328 GAGGGGCTTCTGCGGTGTGAGGG + Intronic
1157573712 18:48730324-48730346 GAGGGGCCCCTGCGGTGTGAGGG + Intronic
1157573718 18:48730342-48730364 GAGGGGCTCCTGCTGTGTGAGGG + Intronic
1157573723 18:48730360-48730382 GAGGGGCCCCTGCGGTGTGAGGG + Intronic
1157573729 18:48730378-48730400 GAGGGGCTCCTGCTGTGTGAGGG + Intronic
1157573738 18:48730414-48730436 GTGGGGCCCCTGCGCTGTGAGGG + Intronic
1157573745 18:48730432-48730454 GAGGGGCCCCTGTGGTGTGAGGG + Intronic
1157573752 18:48730450-48730472 GAGGGGCTTCCGCGGTGTGAGGG + Intronic
1157573757 18:48730468-48730490 GAGGGGCTTCCGCGGTGTGAGGG + Intronic
1157573762 18:48730486-48730508 GAGGGGCTTCTGCGGTGTGAGGG + Intronic
1157573766 18:48730504-48730526 GAGGGGCTTCTGCGGTGTGAGGG + Intronic
1157573770 18:48730522-48730544 GAGGGGCCCCTGTGGTGTGAGGG + Intronic
1157573776 18:48730540-48730562 GAGGGGCTTCTGCTGTGTGAGGG + Intronic
1157573780 18:48730558-48730580 GAGGGGCTTCTGCGGTGTGAGGG + Intronic
1157573784 18:48730576-48730598 GAGGGGCCCCTGTGGTGTGAGGG + Intronic
1157573790 18:48730594-48730616 GAGGGGCTTCTGCTGTGTGAGGG + Intronic
1157573794 18:48730612-48730634 GAGGGGCTCCTGCGGTGTGAGGG + Intronic
1157573799 18:48730630-48730652 GAGGGGCCCCTGTGGTGTGAGGG + Intronic
1157573806 18:48730648-48730670 GAGGGGCTTCTGCGGTGTGAGGG + Intronic
1157573812 18:48730684-48730706 GAGGAGCCCCTGAGGTGTGAGGG + Intronic
1157573819 18:48730702-48730724 GAGGGGCTTCCGCGGTGTGAGGG + Intronic
1157573826 18:48730738-48730760 GAGGAGCCCCCGCAGCTTGAGGG + Intronic
1157573853 18:48730821-48730843 GAGGGGCTTCCGTGGTGTGAGGG + Intronic
1157573856 18:48730839-48730861 GAGGGACCCCCGCAGCATGAGGG + Intronic
1157573863 18:48730858-48730880 AGGGGCCTCCCGCAGTGTGAGGG + Intronic
1160414362 18:78697668-78697690 GAGGAGCCCGCGATGTGTGAGGG - Intergenic
1160463252 18:79055270-79055292 CAGGTCCCCCCGCACTGTGAAGG - Intergenic
1163138853 19:15332676-15332698 GAGGAGACCCCGCAGAGCGAAGG + Intergenic
1163774946 19:19212373-19212395 GAGGGGCCCCCCGAGTTTGGAGG + Intronic
1165830767 19:38729193-38729215 GAGGGGTCCCTGCAGTGGGAGGG + Intronic
1165943090 19:39425026-39425048 GAGGGGCCCCCGCAGCCTCCCGG + Exonic
926157736 2:10466888-10466910 GAGGGGGCCCCACAGGCTGACGG + Intergenic
929460848 2:42101330-42101352 GCGGGGCTCCCCCAGTGTGTCGG - Intergenic
932218538 2:69982887-69982909 CAGAGGCCCCCACAGGGTGAGGG - Intergenic
932572672 2:72946128-72946150 GAGGGGGCCCCGGAGTGGGCAGG - Intronic
935922493 2:108031486-108031508 GAGGGGCTCCCACAGTGGGGCGG - Intergenic
938150441 2:128877944-128877966 GATGGGCCCTCCCAGTGTAATGG - Intergenic
938316882 2:130335849-130335871 AAGGGGCCCCCACAGTCTCATGG - Intergenic
947112524 2:226734434-226734456 CACGGGCCTCAGCAGTGTGAGGG + Exonic
949046263 2:241873888-241873910 GAGGGGCCCCTGCAGGGTGGAGG - Intergenic
1170207244 20:13811583-13811605 GTGGGGCCTCAGCAGGGTGAAGG + Intronic
1173212492 20:41046465-41046487 GATGGGCGCCCCCAGTCTGATGG - Intronic
1176021311 20:62963687-62963709 CGGGGGCTCCCGCAGGGTGAAGG + Intronic
1178411381 21:32366345-32366367 CAGGGGTCCCTGCTGTGTGATGG + Intronic
1181026230 22:20129355-20129377 GAGAGTCCCCAGCAGTGAGAAGG + Intergenic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1183228223 22:36564565-36564587 GAGGCGTCCCTGGAGTGTGAGGG + Exonic
1184977316 22:48071621-48071643 GAGGGGTCTGCGCAGGGTGAGGG - Intergenic
1185229194 22:49670634-49670656 GAGGGGCCCCCACAGCGCGGTGG + Intergenic
949489878 3:4578901-4578923 GAGGGGGCCCCACAGGGTCAAGG + Intronic
950533781 3:13568113-13568135 GAGGTGGCACCTCAGTGTGAGGG + Intronic
950663791 3:14482729-14482751 CAGGGGCCCCCCCAGTTTCAAGG - Intronic
954417928 3:50403167-50403189 GAGGGGCCCTGGCAGTGTTTTGG - Intronic
956642161 3:71425470-71425492 AAGGGGCCACTGCAGTGTGGAGG + Intronic
958553603 3:95645783-95645805 GAGGGGCACCAGCTGTATGAGGG - Intergenic
961186361 3:124918463-124918485 TATGGGACCCTGCAGTGTGATGG - Intronic
961200604 3:125042697-125042719 GAAGGGCCCCTGCTGTCTGAAGG - Intronic
961318414 3:126056249-126056271 GAGGGGCCTCTACAGTGGGAGGG - Intronic
961462017 3:127056543-127056565 GAGGGGCCCCCACAGTGCAGTGG + Intergenic
961483047 3:127196414-127196436 GAGTGGCCCCTGCAGTGGGAGGG - Intronic
961828585 3:129611822-129611844 GAGGGGCCCCTAGAATGTGAAGG - Intergenic
964138417 3:153370196-153370218 GAGGGGCTCCCACAGTGCAACGG + Intergenic
965652303 3:170947162-170947184 GAGGGGCTCCCACAGTGCAATGG - Intergenic
965744272 3:171907487-171907509 GAGGGGCTCCCACAGTGCGGCGG + Intronic
967954455 3:194867698-194867720 GAGGGGACCCAGTAGTGTGGAGG - Intergenic
968044802 3:195618021-195618043 GAGGGGCCTCGGCAGGGTGGGGG + Intergenic
968060586 3:195724073-195724095 GAGGGGCCTCGGCAGGGTGGGGG + Intronic
968636896 4:1685264-1685286 GAGGGGCCCCTGGGGTGGGAGGG + Intergenic
968716100 4:2161193-2161215 AAGGGGCTCCCACAGTGTGGCGG - Intronic
968907841 4:3462846-3462868 GAGGGGTCACCTCAGTGTGGGGG + Intergenic
969703458 4:8780152-8780174 GAAGGGCGCCCGCATTGTGCAGG + Intergenic
969781824 4:9410044-9410066 GAGGGGCCCCCACAGTGCAGCGG + Intergenic
970169337 4:13274296-13274318 CAGAGGCCCACGGAGTGTGATGG + Intergenic
970186820 4:13464155-13464177 TAGGGGCCCCCTCAGTCTTAGGG + Intronic
977177499 4:93834843-93834865 GAGGGGCCCCGGCCGAGTGCGGG - Intergenic
978944791 4:114482119-114482141 GAGGGTCCCCCACAGTGTAGCGG + Intergenic
979829298 4:125280873-125280895 GAGGGGCCCCCCCAGTGCAGTGG - Intergenic
982630196 4:157821929-157821951 AAGGGGCCCCCACAGTGTAGTGG - Intergenic
982701734 4:158664918-158664940 GAGGGGCCCCCACAGTGCAGCGG - Intergenic
983428711 4:167620260-167620282 GAGTAGCCACAGCAGTGTGAAGG + Intergenic
985323025 4:188735334-188735356 GAGGGGCCCCCACAGTGCAGTGG + Intergenic
985628773 5:1004383-1004405 GAGGGGCGTCCCCTGTGTGAGGG - Intergenic
985628777 5:1004401-1004423 GAGGGGCATCCGCTGTGTGAGGG - Intergenic
986171675 5:5319573-5319595 GAGGGGCCCTCCTAGTGGGAGGG - Exonic
988605983 5:32678711-32678733 GAGGGGCCCCCACAGTGCAGTGG + Intergenic
989291175 5:39768016-39768038 GAGTGTGCCCTGCAGTGTGATGG - Intergenic
992277078 5:75131216-75131238 AAGGGGCCCCCACAGTGCAACGG + Intronic
992803034 5:80310387-80310409 GAGGGGCTCCCACAGTGTGGTGG + Intergenic
994736528 5:103562832-103562854 GGGGGGCCCCCGCGGTTTTATGG + Intergenic
995529086 5:113074980-113075002 GAGGGGCCCCCACAGTGCAGTGG - Intronic
995582574 5:113617241-113617263 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
995658422 5:114453150-114453172 GAGTGACTCCCTCAGTGTGAGGG - Intronic
995705928 5:114989623-114989645 GAGGGGCCCCCACAGTGCAGCGG - Intergenic
996478753 5:123949624-123949646 GAGGGGCCCCCACAGTGCAGTGG + Intergenic
997373946 5:133383608-133383630 GAGGTGTCCCCGCCGAGTGATGG - Intronic
998107667 5:139478582-139478604 CATTGGCCCCCGCAGTGTGTGGG + Intronic
998117479 5:139549267-139549289 GAGGGGCTCCCGCAGTGCAGCGG - Intronic
1002445482 5:179287721-179287743 GAGGAGCACCCGCTGTGGGAAGG - Intronic
1004811765 6:19270708-19270730 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1006348422 6:33502643-33502665 GAGGGGCTCCCACAGTGCGGCGG - Intergenic
1007038813 6:38702790-38702812 GTGGGGCCCGCGAAGTGTGGAGG - Intronic
1007446077 6:41907180-41907202 CAGGGGCTCCCGCAGTGTTTGGG - Exonic
1011825790 6:91303566-91303588 GAGGGGCCCCCACAGTGCAGGGG + Intergenic
1014233892 6:118934577-118934599 GGCGCGCCCCCGCAGTGAGAGGG - Intronic
1018170132 6:161137988-161138010 GAGGGGCCCCTTCAGGATGAAGG - Intronic
1018961867 6:168455067-168455089 TAGGGGCCCCTGCAGGGTGCCGG + Intronic
1019331435 7:462645-462667 GAGCGCCGCCCGCAGTGGGACGG + Intergenic
1019411547 7:908919-908941 AAGGGGCCCCCGCTGTGTCCTGG - Intronic
1019708809 7:2509108-2509130 GAGGGGCCGGGGCAGTGTCAGGG + Intergenic
1022791468 7:33693449-33693471 GAGGGGCCACCAGAGTTTGATGG + Intergenic
1029437749 7:100572486-100572508 GAGGGGCCCCGGGAGGGTGATGG + Exonic
1029663267 7:101978025-101978047 GTGGGGACCCAGCAGAGTGATGG - Intronic
1029912315 7:104166415-104166437 GAGAGGCTCCTTCAGTGTGATGG + Intronic
1030146732 7:106364469-106364491 GACAGGCCCCCGGTGTGTGATGG - Intergenic
1030950968 7:115790168-115790190 GAGGGGCCCCCACAGTGCAGTGG + Intergenic
1034674709 7:152884112-152884134 GAGAGGCACCCGCAGGGTGCTGG + Intergenic
1035348703 7:158227487-158227509 GAGGAGCCCCTGACGTGTGACGG + Intronic
1035878285 8:3215542-3215564 GAGGGGCCCCAGAAGTGGGCAGG - Intronic
1038038103 8:23703175-23703197 GAGGAGCCTGCGCAGAGTGAAGG - Intronic
1041048099 8:53906425-53906447 GAGTGGCCCCCTAAGTGTGCTGG + Intronic
1048876043 8:138837673-138837695 GAGGAGCCCCAGCAGTGGGAGGG + Intronic
1051935791 9:22440953-22440975 GAGGGGCCCCCACAGTGCAGCGG - Intergenic
1055724578 9:79213636-79213658 GAGGCCCACCCACAGTGTGAAGG + Intergenic
1056101065 9:83301146-83301168 GGGGGGGCCCTGCAGTGTGCTGG + Intronic
1058065170 9:100540563-100540585 GAGGGGCCCCCACAGTGCAGTGG + Intronic
1058379624 9:104363337-104363359 GAGGGGCTCCCACAGTGTAGTGG + Intergenic
1058717744 9:107737930-107737952 GAAGGAGCCCCGCAGGGTGAAGG + Intergenic
1061357975 9:130120675-130120697 GAGGGGCCTCCGCAGAGTCAAGG + Intronic
1062302900 9:135885446-135885468 CAGGGGACCCCTCAGAGTGATGG + Intronic
1185737441 X:2503983-2504005 AAGGGGCACCCCCAGTGTGCAGG + Intergenic
1189917145 X:45866622-45866644 GAGTGGGCCCTGCAGTGGGATGG + Intergenic
1190008135 X:46759187-46759209 GAGGGGCGCGCGCAGTGCGCAGG + Intergenic
1201259440 Y:12144135-12144157 GTGGGGCACTCACAGTGTGAGGG + Intergenic
1202242416 Y:22785515-22785537 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1202395401 Y:24419264-24419286 GAGGGGCCCCCACAGTGCAGTGG - Intergenic
1202475384 Y:25250828-25250850 GAGGGGCCCCCACAGTGCAGTGG + Intergenic