ID: 1157578124

View in Genome Browser
Species Human (GRCh38)
Location 18:48757594-48757616
Sequence GGTTCACTGTTATCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157578118_1157578124 15 Left 1157578118 18:48757556-48757578 CCAAAGGCCATATGTGATGACAG 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1157578124 18:48757594-48757616 GGTTCACTGTTATCTGCTACTGG 0: 1
1: 0
2: 1
3: 9
4: 84
1157578119_1157578124 8 Left 1157578119 18:48757563-48757585 CCATATGTGATGACAGAGTCAGA 0: 1
1: 0
2: 3
3: 23
4: 227
Right 1157578124 18:48757594-48757616 GGTTCACTGTTATCTGCTACTGG 0: 1
1: 0
2: 1
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157578124 Original CRISPR GGTTCACTGTTATCTGCTAC TGG Intronic
901205103 1:7490070-7490092 GGGTGACTGCTTTCTGCTACAGG + Intronic
902906227 1:19559667-19559689 GGTTTACTGCTATAAGCTACAGG + Intergenic
909232434 1:73106799-73106821 GGTTCACTATTCTCTTCCACTGG - Intergenic
910713708 1:90207946-90207968 GGTTCACTGCTATCAGCTCACGG + Intergenic
916504295 1:165413973-165413995 GTCTCTCTGTTATCTGCTCCAGG + Intronic
918280742 1:183002795-183002817 GGTCCTCTATTATATGCTACGGG - Intergenic
918978378 1:191522135-191522157 GGTTCTCTGTTATTTTCCACAGG + Intergenic
923083528 1:230683347-230683369 GGTTCTCTGTTATTTGCAGCTGG - Intronic
1064350009 10:14568037-14568059 GGCTCACAGTCATCTGCTGCAGG - Intronic
1066037189 10:31504288-31504310 GGTTCTCTGTTCTCTTCCACTGG + Intronic
1074820973 10:117178165-117178187 GATTCTCTGGTATCTGCCACAGG + Intergenic
1079495922 11:21043984-21044006 AGTTCAAAGATATCTGCTACTGG + Intronic
1079734518 11:23979255-23979277 GGTTCACTGGTAAATTCTACTGG - Intergenic
1083025449 11:59546946-59546968 GGTTCAGTGTTATCTCCTCTTGG - Intergenic
1088025495 11:105176533-105176555 GGTTCTATGTTATCTTCTAAAGG + Intergenic
1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG + Intergenic
1093476139 12:19556579-19556601 GGTTCGCTGTTCTGTCCTACTGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099726203 12:86431194-86431216 GGTTGACTGGTATCTGCAATTGG + Intronic
1100443199 12:94636757-94636779 TGTTCACTGTTTTCTGCCACAGG - Intronic
1101332550 12:103768863-103768885 GGTTTACTGTTAGCTGTTACTGG + Intergenic
1103219796 12:119234197-119234219 GGACCAATGTCATCTGCTACAGG - Intergenic
1114711036 14:24778479-24778501 GATTCACTCTAATCTCCTACTGG + Intergenic
1116015394 14:39401142-39401164 TGTTCATTGTAATCTGATACTGG - Intronic
1117683948 14:58234131-58234153 TATTCACTATTATCTGCTAAAGG + Intronic
1122184348 14:99979085-99979107 GGCTTACTGTTGTCTGGTACTGG + Intronic
1122784197 14:104156417-104156439 GGTTCGCCCTTTTCTGCTACTGG + Intronic
1122799903 14:104224362-104224384 GGTTCGATGTAATCTGCTCCAGG + Intergenic
1125820803 15:42628759-42628781 GGTTCACTGTTTTGTTCTATTGG + Intronic
1137245372 16:46699013-46699035 GGTTGCCTTTTATCTGCTACAGG + Intergenic
1137806951 16:51316017-51316039 GGTTCAGTTTTAGCTGCTTCTGG + Intergenic
1144439334 17:15267217-15267239 TGTTCACTGTTGTGTGCCACTGG + Intergenic
1147221380 17:38933310-38933332 GTTTCACAGTTACCTGCTAGTGG + Intergenic
1147734075 17:42623463-42623485 ATTTCCCTGTTATCTACTACAGG + Intergenic
1150515259 17:65802280-65802302 TGTTCACTGTTGTTTGCTACAGG + Intronic
1154095328 18:11409639-11409661 GGTAATCTGTTATCTGCCACAGG - Intergenic
1157578124 18:48757594-48757616 GGTTCACTGTTATCTGCTACTGG + Intronic
1166582884 19:43918258-43918280 GATTCACTATTAACAGCTACAGG + Intronic
925097392 2:1218135-1218157 GGTTACCTGTTACCTGCTGCTGG - Intronic
933373216 2:81443991-81444013 GTTTCTCTGTTGTCTGATACAGG + Intergenic
936710160 2:115122295-115122317 TGTTCACTCTGATCTGCCACAGG - Intronic
938257271 2:129868999-129869021 GGTTTACTTTTATGTGCCACTGG - Intergenic
945390054 2:209254442-209254464 AATTCACTGTTTTCTGCTACTGG + Intergenic
947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG + Intronic
1170451074 20:16484398-16484420 AGTTCATTGTTCTCTGCAACTGG - Intronic
1173409358 20:42795919-42795941 GGCTCACTGTTACCTGCTGTTGG - Intronic
1176082945 20:63283076-63283098 TGTTCACTGGTAGCTGGTACCGG + Intronic
950730982 3:14957295-14957317 TGTTCATTGTTATCTGAAACTGG + Intronic
953195078 3:40724506-40724528 GATTCACTGTTACCTGCATCTGG + Intergenic
955066190 3:55535549-55535571 TTTCCACTGTTATCTGCTGCCGG - Intronic
963179809 3:142342602-142342624 GGTTCACTGTTCTGTTCCACCGG - Intronic
965940404 3:174172648-174172670 GGTTCTCTGTTATTTTCTACTGG + Intronic
970303449 4:14705487-14705509 CATTCACTGACATCTGCTACTGG + Intergenic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
976031100 4:80754772-80754794 GGTTCATTGGTACCTGCTCCAGG + Intronic
978047656 4:104151713-104151735 TATTCCCTGTTTTCTGCTACTGG - Intergenic
979280487 4:118861673-118861695 GCTTCTCTGTTATATTCTACTGG + Intronic
979303138 4:119110378-119110400 GGCTCATTATTATCTGCTTCTGG + Intergenic
982243439 4:153323899-153323921 GGATCCATGTTATCTGCAACTGG + Intronic
983552005 4:169026995-169027017 AATTCACTATTATCTGCCACAGG - Intergenic
988173846 5:27694779-27694801 GGTTCTCTATTCTCTTCTACTGG - Intergenic
994162078 5:96567996-96568018 GCTTCATTTTTATCTGCTTCAGG + Intronic
1010316960 6:74462754-74462776 GGTTCACTATTCTCTTCCACTGG + Intergenic
1012332644 6:98012162-98012184 GCTTAACTGTAATCTGTTACTGG - Intergenic
1018552472 6:165013566-165013588 ACTTCACTGCTATCTGCTTCTGG + Intergenic
1019872712 7:3780471-3780493 AGTTGACTGGTATCTGCTATTGG - Intronic
1021060565 7:16105628-16105650 GGTTGACTGATATCTGCAATTGG - Intronic
1022344750 7:29503363-29503385 GGTTCATTGTTCACTGCTAGGGG + Intronic
1028689092 7:93630283-93630305 GGTTGACTGTTATTTTCTTCAGG + Intronic
1030796124 7:113790181-113790203 GGTCCAGTGTTATCAGCAACTGG - Intergenic
1040624234 8:49127652-49127674 GGTTCACTGGTAAATTCTACTGG - Intergenic
1042681897 8:71395082-71395104 GGTTCTCTGTTGTCTGTTATTGG + Intergenic
1045890368 8:107149006-107149028 AGATCCCTGCTATCTGCTACTGG + Intergenic
1046280784 8:112027793-112027815 GTTTCACTCTTATCTCCTTCTGG + Intergenic
1050269783 9:3930261-3930283 TGTTCACTGTTTTCTGCAAGTGG - Intronic
1050636426 9:7617622-7617644 GGTTTAATGTTCTCTGCTGCTGG - Intergenic
1050744829 9:8863192-8863214 GGTACAATGCTATTTGCTACTGG + Intronic
1051018178 9:12507136-12507158 GGCTCTCTGTTGTCTGTTACTGG - Intergenic
1052574476 9:30274532-30274554 TGTTCATTTTTATATGCTACTGG - Intergenic
1053067197 9:35077075-35077097 GGTTCCCTGTGATCAGCTCCTGG + Exonic
1053292587 9:36891297-36891319 TGTTCACTGTCATCTGCTTCGGG - Intronic
1055301320 9:74886347-74886369 GTTTCACTGTCATCTGCTTTGGG - Intronic
1055407237 9:75987713-75987735 GGTTCACTCTTTGCGGCTACTGG - Intronic
1056131831 9:83594631-83594653 AGTTCACTATTTTCTGTTACAGG - Intergenic
1056722748 9:89085715-89085737 GGTTCAGTGTTACCTTCTGCAGG - Intronic
1059134214 9:111788495-111788517 GGTTCTGTGTTATCTGATACAGG - Intronic
1059880214 9:118679896-118679918 GGTTCCCTTTCATCTGCTAATGG - Intergenic
1061435244 9:130557164-130557186 GTTACACTGCTACCTGCTACAGG - Intergenic
1061815272 9:133190934-133190956 GGTTCACTGTCATATTCTAGGGG + Intergenic
1187552273 X:20317917-20317939 TGATCAGGGTTATCTGCTACCGG + Intergenic
1189176331 X:38961284-38961306 GCTTCACTGTTATCTGCTGCTGG - Intergenic
1190476003 X:50827989-50828011 TGTTTACTGTTACATGCTACTGG + Intergenic
1194398970 X:93419971-93419993 GTTTCTCTGTTAACTGCCACAGG + Intergenic
1195890048 X:109683666-109683688 GGTTCATTGTCATCACCTACAGG - Exonic
1196536033 X:116845534-116845556 GGTACACTGTTATATGCTATGGG + Intergenic