ID: 1157578483

View in Genome Browser
Species Human (GRCh38)
Location 18:48759374-48759396
Sequence TGCCCCAGAGGCCAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157578478_1157578483 -4 Left 1157578478 18:48759355-48759377 CCGACTCTCCTCAAGCTCTTGCC No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578477_1157578483 3 Left 1157578477 18:48759348-48759370 CCTACTGCCGACTCTCCTCAAGC No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578474_1157578483 8 Left 1157578474 18:48759343-48759365 CCTCCCCTACTGCCGACTCTCCT No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578473_1157578483 12 Left 1157578473 18:48759339-48759361 CCATCCTCCCCTACTGCCGACTC No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578475_1157578483 5 Left 1157578475 18:48759346-48759368 CCCCTACTGCCGACTCTCCTCAA No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578476_1157578483 4 Left 1157578476 18:48759347-48759369 CCCTACTGCCGACTCTCCTCAAG No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data
1157578472_1157578483 15 Left 1157578472 18:48759336-48759358 CCTCCATCCTCCCCTACTGCCGA No data
Right 1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157578483 Original CRISPR TGCCCCAGAGGCCAGGCCCA GGG Intronic