ID: 1157580602

View in Genome Browser
Species Human (GRCh38)
Location 18:48771814-48771836
Sequence CAGATTCCCCGCGGCGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157580602_1157580609 23 Left 1157580602 18:48771814-48771836 CCCCAGCCGCCGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1157580609 18:48771860-48771882 CGCAGCATCTCTGCCCTGCCCGG 0: 1
1: 0
2: 0
3: 23
4: 279
1157580602_1157580607 -8 Left 1157580602 18:48771814-48771836 CCCCAGCCGCCGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1157580607 18:48771829-48771851 GGAATCTGAGCTATGCTAAGCGG 0: 1
1: 0
2: 0
3: 6
4: 117
1157580602_1157580610 24 Left 1157580602 18:48771814-48771836 CCCCAGCCGCCGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1157580610 18:48771861-48771883 GCAGCATCTCTGCCCTGCCCGGG 0: 1
1: 0
2: 7
3: 63
4: 444
1157580602_1157580611 29 Left 1157580602 18:48771814-48771836 CCCCAGCCGCCGCGGGGAATCTG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1157580611 18:48771866-48771888 ATCTCTGCCCTGCCCGGGCACGG 0: 1
1: 0
2: 6
3: 33
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157580602 Original CRISPR CAGATTCCCCGCGGCGGCTG GGG (reversed) Intronic
900386186 1:2412158-2412180 CAGGTCCCCCGCGGTGTCTGCGG + Intronic
900571067 1:3358476-3358498 CAGACTCCCAGCCGCGGCTTCGG + Intronic
901203208 1:7478304-7478326 CAGATTCCCGCCTGAGGCTGCGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
913632518 1:120723948-120723970 CAAACTTCCGGCGGCGGCTGAGG + Intergenic
916174209 1:162024033-162024055 CAGCTGCCGCGCGCCGGCTGAGG + Intergenic
1063968232 10:11363274-11363296 CAGCTTCCCCAGGGCTGCTGCGG - Intergenic
1067907429 10:50308129-50308151 CAGATTCCCCTCGGCGACTCTGG - Exonic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1072571736 10:96663975-96663997 CAGATACCCCCCAGCTGCTGAGG + Intronic
1076869662 10:133187168-133187190 CAGCGTCCCCGCGGAGGCAGCGG - Intronic
1081528826 11:43944267-43944289 CTGATTCCTGGCGGCGGGTGGGG + Intronic
1084618407 11:70251826-70251848 CGGCTTCCCCGGGGAGGCTGTGG + Intergenic
1089778900 11:120859433-120859455 CAGATTCACAGTGGCAGCTGGGG - Intronic
1090202500 11:124866391-124866413 CAGCTTCCCCGCGGCGCTAGGGG - Intronic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1096203807 12:49705685-49705707 CCGATCCCCCGAGGAGGCTGGGG + Intronic
1097264100 12:57736146-57736168 CAGAGTTCCCGCCGCAGCTGCGG - Intronic
1100978075 12:100142783-100142805 CGGGTTCTCGGCGGCGGCTGTGG - Exonic
1103789279 12:123458137-123458159 CAGATTCTCCGCGCCGGCCTCGG - Intronic
1108622199 13:52195413-52195435 CAGATTCCCCGCGGGCGCGCGGG + Intergenic
1112046672 13:95604335-95604357 CAGCTTCCCCAGGGCGGCAGGGG - Intronic
1114398390 14:22387458-22387480 CAGATTCCTCGTGGCAACTGAGG - Intergenic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1115399356 14:32939522-32939544 CATTGTCCCCGCGGCGGCTGCGG + Intronic
1116951215 14:50880461-50880483 CATCTTCCCCCCGGCAGCTGGGG - Exonic
1122096235 14:99374932-99374954 CAGATTCCCAAAGGCGGGTGTGG - Intergenic
1122427623 14:101620958-101620980 GAGATTCCCCGCTGGGGCTTGGG + Intergenic
1124192831 15:27595488-27595510 CTGACTCCCTGCGGAGGCTGTGG + Intergenic
1129408802 15:75337665-75337687 CAGCTTCCCTGCTGCTGCTGGGG - Intronic
1129540859 15:76346302-76346324 CCAATTCCCCGCAGCGGCGGCGG - Intergenic
1131735472 15:95326951-95326973 CGGATTGGCCGCGGCGGCTGCGG + Intergenic
1132646521 16:1001771-1001793 CAGATTCCCAGGGTCAGCTGTGG + Intergenic
1132757574 16:1493520-1493542 CCGATTCCCCACGGCCGCCGCGG - Exonic
1134240510 16:12502521-12502543 CAGCTTCCCCACGGTGGCCGGGG + Intronic
1141703415 16:85652537-85652559 AAGATTCCAGGCGGCGGCGGCGG + Intronic
1142560396 17:806044-806066 CAGGTTCCCCCCGGCGGCACTGG - Intronic
1142683107 17:1561967-1561989 GAGAGGCCCCGCGGCGGCCGAGG - Intronic
1143122419 17:4617122-4617144 CAGGTTCCCCGCGGGGTCTCTGG - Intergenic
1143392464 17:6567802-6567824 CAGATCTCCCGGGGCTGCTGGGG + Intergenic
1146721609 17:35127943-35127965 CAGATTCCCAGAGGATGCTGTGG + Intronic
1148143263 17:45343077-45343099 CCGATTCCCAGCTGCAGCTGGGG - Intergenic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1160511593 18:79456251-79456273 CACATTCACCGCGGCGAGTGTGG + Intronic
1160733754 19:652574-652596 CAGATTAGCCGCCGAGGCTGAGG + Intronic
1161625967 19:5327027-5327049 CAGTTTCCCCACTGAGGCTGAGG + Intronic
1162147347 19:8620933-8620955 CAGTTTCCCCTCTGCAGCTGGGG + Intergenic
1163329596 19:16628044-16628066 CATGTTCCCCGCGGCGCCGGGGG + Exonic
1164544159 19:29145245-29145267 CAGAATCCCCTGGGGGGCTGAGG - Intergenic
1165248781 19:34513646-34513668 CAGATTCCCAGGTGAGGCTGAGG - Intergenic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
926686744 2:15704092-15704114 CAGCTTCCCCAGGGAGGCTGGGG + Intronic
934079061 2:88452308-88452330 CAGGTACGCGGCGGCGGCTGCGG + Exonic
942045843 2:172099081-172099103 GAGGTCCCCCGCGGCGGCTGGGG + Intergenic
944809292 2:203312194-203312216 CAGATCCCCACCGGAGGCTGAGG + Intergenic
947641707 2:231710690-231710712 CGGCCTCCCCGCGGCGGCTAGGG - Intronic
1170090889 20:12588893-12588915 CAGCTTCCGCTCGGCTGCTGGGG + Intergenic
1173287672 20:41687878-41687900 CAGATTCCCCTTGGAGCCTGAGG - Intergenic
1175550188 20:59812560-59812582 CAGTGTCCCCGCAGAGGCTGTGG + Intronic
1175990039 20:62784223-62784245 CAGATTCCTCGCTCCCGCTGTGG + Intergenic
1183457474 22:37930498-37930520 CAGCTTTCCCTCGGCAGCTGCGG - Intronic
1184817706 22:46884652-46884674 CAGATTCCCTGTGGCTGCTCTGG - Intronic
953558261 3:43964130-43964152 CAGATTTTCCACGGCTGCTGTGG - Intergenic
954669028 3:52278353-52278375 CAGCTTCATGGCGGCGGCTGGGG + Exonic
960602126 3:119468982-119469004 CAGATTCCCCGCTGCGGCGCTGG - Exonic
962103215 3:132364230-132364252 CAGCTTCCCCCGGGAGGCTGAGG + Intronic
967781140 3:193440897-193440919 CACATTCCCCGTGACAGCTGAGG - Intronic
968575069 4:1362227-1362249 CCGCCTCCCCGCGGTGGCTGGGG + Intronic
968708036 4:2092533-2092555 CAGCTCCCCCACGGTGGCTGCGG + Intronic
971327428 4:25655732-25655754 CAGTGCCCCGGCGGCGGCTGCGG + Intronic
976276557 4:83284575-83284597 CAGTTTGTCCGCGGCGGCGGTGG - Exonic
976765458 4:88593080-88593102 CAAACTCCTCGCGGCCGCTGAGG - Intronic
988109941 5:26807439-26807461 CAGATGCCCAGCTGCGGCTCTGG + Intergenic
989379270 5:40797897-40797919 CCGCAGCCCCGCGGCGGCTGGGG + Intronic
999997589 5:157106877-157106899 GAGGTTCCCTGGGGCGGCTGGGG + Exonic
1001550473 5:172598720-172598742 CAGAGGCCCCGTGGGGGCTGTGG - Intergenic
1003139175 6:3456806-3456828 CTGATGAGCCGCGGCGGCTGAGG - Intronic
1003624097 6:7727062-7727084 CAGCTGCCCCCCGGCGGCGGCGG - Exonic
1005781793 6:29200958-29200980 CAGTTGCCCAGCAGCGGCTGTGG + Intergenic
1013152395 6:107459214-107459236 CGGGTTCCCCGCGTCGCCTGTGG - Exonic
1018950317 6:168374592-168374614 CAGCTTCCCTGTGGTGGCTGCGG + Intergenic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1028468621 7:91180122-91180144 CAGATTCCCCTTGTCAGCTGAGG + Intronic
1031665314 7:124476313-124476335 CAGAGTCCCTGCAGCAGCTGAGG + Intergenic
1036562095 8:9906405-9906427 CAGAGTCCCCTCGGCGGCCGCGG + Intergenic
1042848291 8:73190208-73190230 CAGATTCCTTGCGGGGGCAGAGG - Intergenic
1044474115 8:92606150-92606172 CAGCTCCCCCGCGCCAGCTGGGG - Intergenic
1046108295 8:109691887-109691909 CGGATCCCCGGGGGCGGCTGAGG + Intergenic
1057997147 9:99828722-99828744 CTGGCTGCCCGCGGCGGCTGCGG - Exonic
1185909448 X:3968764-3968786 CTGATTTCCCTCGGCGGGTGGGG - Intergenic
1196425077 X:115561605-115561627 CTGATTCCCCTCCGCGGCTGCGG + Intronic