ID: 1157584170

View in Genome Browser
Species Human (GRCh38)
Location 18:48790753-48790775
Sequence CCCCGCCCGGCTGGAGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157584163_1157584170 8 Left 1157584163 18:48790722-48790744 CCAAGTCTAGCTCTGAAGTTCCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG 0: 1
1: 0
2: 2
3: 22
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157584170 Original CRISPR CCCCGCCCGGCTGGAGCCAC GGG Intronic
900362762 1:2297882-2297904 TCCTGCCAGGCTGCAGCCACGGG - Intronic
900427162 1:2586157-2586179 CCCCGCCCCGCGGGAGACCCCGG + Intergenic
900618216 1:3574931-3574953 CCACGCCTGGCTTGAGCCAAAGG + Intronic
901023306 1:6266007-6266029 CCTCGCCGGCCTGGAGCCAATGG + Intronic
901642542 1:10700171-10700193 CCCGCCCGGGCTGGGGCCACAGG - Intronic
905037739 1:34929145-34929167 CCTCGCCCGGCTGGAGGCTCGGG - Intronic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
905900952 1:41581694-41581716 ACCCGCGCTGGTGGAGCCACTGG + Exonic
906315939 1:44786437-44786459 CGCCGCCCGCCGGGAGCCTCTGG - Intronic
912491333 1:110064407-110064429 CCCAGCTCTGCTGCAGCCACAGG - Intronic
913655103 1:120952757-120952779 CCCTGCCCTGGTGGAGCCCCGGG - Intergenic
914645288 1:149646917-149646939 CCCTGCCCTGGTGGAGCCCCGGG - Intergenic
915191661 1:154155937-154155959 CCGCACCCAGCTGGAGCAACAGG - Intronic
915317037 1:155034484-155034506 ACTCGCCCGGCTGGCGCCACAGG - Exonic
916052599 1:161046996-161047018 TCCAGCCAGGCTGGGGCCACAGG - Exonic
917375672 1:174349322-174349344 CACCTCCCGGATGGGGCCACTGG + Intronic
917632703 1:176905619-176905641 TCCCTGCCTGCTGGAGCCACAGG + Intronic
920053901 1:203179377-203179399 TCCCGGCCAGCTGGAGCCAGAGG + Exonic
921088133 1:211815714-211815736 TCCCTCCCTGCTGCAGCCACTGG + Intronic
922295559 1:224246915-224246937 CCCCACGCAGCTGGGGCCACAGG - Intronic
922513279 1:226186929-226186951 ACCCGCCCACCTGGAGCAACTGG - Intergenic
1066402605 10:35090349-35090371 CCCCGGCCGGCCGCCGCCACCGG + Exonic
1068544148 10:58327310-58327332 CCCCGATTGGCTGGAGGCACAGG - Intergenic
1069744330 10:70705408-70705430 CCCAGCCCGGCTGGCGGCCCTGG - Intronic
1072294159 10:93993772-93993794 CCCCGCGCGGCAGGAGCCGGGGG + Intergenic
1072899674 10:99395913-99395935 CCCTGTCTGGCTGGAGCCCCAGG - Intergenic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1074314045 10:112345945-112345967 CCCCCACCGACTGGAGCCGCAGG + Intergenic
1074899669 10:117805209-117805231 CCTCGCCCGGCTGGAGGGAGAGG + Intergenic
1076319238 10:129565979-129566001 CCCAGGCAGGCTGGAGCCACAGG + Intronic
1076637427 10:131891546-131891568 CCCCGCCGGGCTGGGTACACTGG - Intergenic
1076774274 10:132685693-132685715 CACCTCCCGGACGGAGCCACCGG - Intronic
1076999772 11:316673-316695 CCCCTCCCGGGTGGGGCCGCAGG + Intergenic
1077021057 11:417337-417359 CCCCGCCCGGCGCGAGCCCCAGG - Intronic
1077476533 11:2792948-2792970 CCCCGCCCCCCGGGAGCCGCAGG + Intronic
1078889372 11:15540197-15540219 CCCCCCACGGCTGGAGTCTCAGG - Intergenic
1081595245 11:44454330-44454352 CCCCGCCCTACTGGAGCTCCTGG - Intergenic
1082691349 11:56308350-56308372 GACAGCCAGGCTGGAGCCACAGG + Intergenic
1083306331 11:61763960-61763982 CCCCACCCTGCTGTAACCACGGG - Intronic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1083619544 11:64042100-64042122 CCCCTCCCGCCTGGTCCCACTGG - Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083813334 11:65117615-65117637 CCCCGCCGGGCAGAAGCCACAGG + Exonic
1083895246 11:65616482-65616504 CCTCTCCCGGCTGGAGTTACAGG - Intronic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1084207988 11:67607083-67607105 CCCAGCCTGGCTGGGGCCACGGG + Intronic
1084265871 11:68004801-68004823 ACCGACCTGGCTGGAGCCACGGG + Intronic
1085317523 11:75554593-75554615 CCCCTCCCTGCTGGAACCTCTGG + Intergenic
1091564704 12:1639774-1639796 CGCCGTCCGGCTGCAGCCGCAGG - Exonic
1091705174 12:2688717-2688739 CCCAGCCAGGCTGGGGCCCCAGG + Exonic
1092533525 12:9364959-9364981 CCACACCCGGCTGTAGCCACTGG + Intergenic
1094635862 12:32226886-32226908 CCCCGCCAGGCTCCAGCCCCAGG - Intronic
1096522389 12:52191698-52191720 CCCCGGCCTGCTGGTGCCCCTGG - Exonic
1102956539 12:117062786-117062808 CCCCGCCGGGCTGGATGAACCGG + Intronic
1103743523 12:123107196-123107218 CCCCTCCCTGCCTGAGCCACGGG + Intronic
1107604001 13:42040729-42040751 CCCCGCCCGGGGCCAGCCACCGG - Intronic
1110468530 13:75830575-75830597 CTCTGCCTGGCTGTAGCCACAGG + Intronic
1112051108 13:95644403-95644425 CCCCGCCCGCCTGCAGCGCCCGG - Intronic
1113750940 13:112776030-112776052 CCTGGCCCGGCTGGAGTCCCTGG + Intronic
1115804799 14:37038845-37038867 CCCTGGTCGGCTGGGGCCACAGG - Intronic
1117094694 14:52285146-52285168 CCATGGCAGGCTGGAGCCACTGG - Intergenic
1117135465 14:52730569-52730591 CGCCCCTCGGCCGGAGCCACAGG - Intronic
1117549096 14:56816762-56816784 CGCCGCCCCGCTGGAGGCGCCGG + Intergenic
1117887449 14:60380219-60380241 CCTCTCCAGGCAGGAGCCACTGG - Intergenic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1119260990 14:73237931-73237953 CCCCTCCCGGGAGGTGCCACTGG + Intronic
1119808589 14:77498575-77498597 CCCCGCACGGCTGGAGCCGGCGG + Intronic
1120863200 14:89273510-89273532 CCACACCAGGCTGTAGCCACTGG + Intronic
1122232903 14:100315975-100315997 TCCAGCCAGGCTGGGGCCACAGG + Intergenic
1122270381 14:100566313-100566335 CCCCGCCCGGCTGGGTGCACAGG - Intronic
1122297061 14:100711697-100711719 CCCAGGCCGGCTGGGGCCCCAGG + Intergenic
1122929314 14:104926132-104926154 CCCAGCCTGGCTGCAGACACTGG + Intronic
1123004383 14:105314445-105314467 CCCCGCCCCCCGGGAGCCGCGGG - Exonic
1123119371 14:105909728-105909750 CCCCGACCCGCCGGAGCCCCCGG + Intergenic
1124136303 15:27038893-27038915 CCCCTCCCGGGTGGAGCCTGAGG + Intronic
1124473398 15:30008973-30008995 CTCCCACCTGCTGGAGCCACTGG - Intergenic
1124640467 15:31393207-31393229 CCCCACCCTGCTGGGGCTACTGG + Intronic
1125744562 15:41989617-41989639 CCCCTCCTGCCTGCAGCCACTGG + Intronic
1125937357 15:43648759-43648781 CCCCGCCCCGCTCGACCCCCAGG + Exonic
1126111767 15:45179405-45179427 CCCTGCCCTCCAGGAGCCACAGG - Intronic
1128109584 15:65068014-65068036 CCCCGCCCGCCAGGCTCCACCGG - Exonic
1128294296 15:66504819-66504841 CTCAGCCCGGCTGCTGCCACAGG + Exonic
1129162114 15:73752851-73752873 CCCAGCCCGGCCGGGGCCCCCGG - Intergenic
1129409067 15:75338879-75338901 CCCAGGCCTCCTGGAGCCACAGG - Intronic
1129539822 15:76340576-76340598 CCCCACCCGACTCGAGCCTCCGG - Intronic
1129658154 15:77538312-77538334 CCCCACCCGGCTGGGGACAGTGG - Intergenic
1129732870 15:77941885-77941907 CCCAGGCCTCCTGGAGCCACAGG + Intergenic
1132482393 16:173040-173062 CCTCGCCCGCCCGGACCCACAGG + Intronic
1132483241 16:176844-176866 CCTCGCCCGCCCGGACCCACAGG + Intronic
1132549251 16:547591-547613 TCCCCCCCAGCTGCAGCCACCGG + Exonic
1134299396 16:12976209-12976231 TCCCGACTAGCTGGAGCCACAGG + Intronic
1136271498 16:29151548-29151570 CCCAGCCGGGCTTCAGCCACAGG - Intergenic
1136395043 16:29987915-29987937 CTCCGCCCGGCTAGAGTCCCTGG - Exonic
1136590925 16:31217158-31217180 CCCCTCCCAGCAGGAGCCACAGG - Exonic
1137607093 16:49794157-49794179 TCCCGAGCAGCTGGAGCCACAGG + Intronic
1137679082 16:50323441-50323463 CCCAGCCCGGCTGGAGGCCACGG - Intronic
1138113100 16:54340058-54340080 CCAGGCCAGGCTGGAGCTACTGG + Intergenic
1139956730 16:70696849-70696871 CCCAGCCCGGCAGGTGCCAGCGG - Intronic
1140091984 16:71846184-71846206 CCCCGGCCCGCCGGAGCAACGGG - Intronic
1141802238 16:86317906-86317928 CTCCGTCCTGCTGGGGCCACTGG - Intergenic
1141959096 16:87392582-87392604 CCCCGCCGGCCGGCAGCCACCGG - Intronic
1142209160 16:88799743-88799765 CTGCCCCCGGCTGGAGCCCCAGG + Intergenic
1142440804 16:90096472-90096494 CCGAGCCCTCCTGGAGCCACTGG - Intergenic
1142593296 17:1017173-1017195 ACCAGCCCGGCTGGAGGCAGGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1146290421 17:31602787-31602809 CACTGCCCGGCTAGAGCCAGCGG + Intergenic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1150394395 17:64809966-64809988 CCCCACCCGCCTGGGGCCAGGGG - Intergenic
1150692367 17:67377469-67377491 CTCTGCCCGGCTGGGGCCCCGGG - Intronic
1150778614 17:68101513-68101535 CCCCGCCCCGCTGACCCCACCGG + Intergenic
1151763787 17:76121963-76121985 CCCCGGTTGCCTGGAGCCACGGG - Intergenic
1151946327 17:77321901-77321923 CTCCGCCCAGCAGGAGCCGCAGG + Intronic
1152103926 17:78318135-78318157 CCCTGCCCTGCTGGACTCACTGG + Intergenic
1152225352 17:79090274-79090296 CCTCGCCAGGCTGGGGGCACGGG + Intronic
1152301522 17:79497789-79497811 CCCCTCCCCTCTGGAGCCAATGG + Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1152822223 17:82443199-82443221 CTGCGCCCGGCTGGAGCTCCCGG + Exonic
1155007615 18:21741919-21741941 CAGCGCCCGGCTGGAGCGAGCGG + Intronic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1160730778 19:640796-640818 CCCCGCCGGGCGGGGGGCACTGG + Intronic
1160801279 19:970867-970889 CCCCGCCCGGCTGTGGTCAGAGG + Intronic
1160818883 19:1048983-1049005 CCCCACCCCGCTGGACCCAAAGG + Exonic
1160825888 19:1080451-1080473 CCTCGCCCGGCTGGAGAAAGAGG - Exonic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161063706 19:2227537-2227559 CCCCGCCCCGCAGCAGCCCCAGG - Intronic
1161366297 19:3881675-3881697 CCCCTGCCAGCTGCAGCCACAGG - Intronic
1162035287 19:7935033-7935055 CCACGCCCGCCTGGAGCCGCTGG - Intronic
1162752654 19:12838414-12838436 TCCCGGCCGGCTGCAGCCGCAGG + Intronic
1162903474 19:13809159-13809181 CCGCGCCCTGCTGCCGCCACAGG - Exonic
1163234516 19:16022901-16022923 CCCCACCTGGCAGGAGGCACAGG + Intergenic
1163406932 19:17128611-17128633 CGCCTACCGGCTTGAGCCACCGG + Intronic
1163691287 19:18739805-18739827 CCCAGCCTGGCTGGAACCCCTGG - Intronic
1163862062 19:19747828-19747850 CCCCACCCAGCAGGAGGCACAGG + Intergenic
1165375330 19:35437730-35437752 CCGCGCCCGGCTGGAGTCCATGG - Intergenic
1165420131 19:35718276-35718298 CCCGGCCCCGCTGGACCCGCGGG - Exonic
1167315505 19:48760714-48760736 TCCCACCCGGCTGCAGCAACTGG - Intergenic
1167994522 19:53391588-53391610 CCCCGAGCAGCTGGGGCCACAGG - Intronic
1168544735 19:57240861-57240883 CCCCGCCCCGCTAGGGCCACAGG + Intronic
1168637923 19:58010650-58010672 ACCCGCCCAGCCGAAGCCACGGG + Exonic
925191595 2:1889321-1889343 CCTCGCCCAGCTGGAAACACCGG + Exonic
925339614 2:3127067-3127089 CCCTGCCCGGCTGCTGCCTCAGG - Intergenic
926036337 2:9638681-9638703 CCCCTCCCAGCTAGAGTCACGGG - Intergenic
926303181 2:11618468-11618490 CCCAGCCCGACTGTAGCCTCAGG + Exonic
927390284 2:22587452-22587474 CCCCAGCCTGTTGGAGCCACTGG + Intergenic
927694364 2:25230267-25230289 CCCCGCCCCACGGGAGCGACAGG - Exonic
929429073 2:41871442-41871464 CCTCCCCCAGCTGGAGCCACAGG - Intergenic
929777620 2:44938728-44938750 CCCCGCCGGGCTGGGGGCGCAGG - Intergenic
932718420 2:74120338-74120360 CCCAGCCCGGCAGGAGCTTCCGG + Intergenic
934557481 2:95295010-95295032 CCCTGCTCTGCTGGACCCACCGG - Intergenic
937982130 2:127622080-127622102 CCCCACCTGGCTGGAGCTGCAGG + Exonic
947257413 2:228181394-228181416 CCCAGCCTCGCTGGAGCTACAGG - Intronic
1170093263 20:12616666-12616688 ACCCGCCTGCCTGGGGCCACTGG + Intergenic
1170557980 20:17530993-17531015 GCGCGCCCGGCTGGAGCGCCAGG - Exonic
1170821367 20:19758229-19758251 CCCCGCCCGGGAGGAGCAAGAGG - Intergenic
1171965107 20:31523898-31523920 ACCCTCCCCTCTGGAGCCACTGG - Intronic
1173666728 20:44768367-44768389 CCCCGCAAGGCTGCAGCCCCTGG - Intronic
1173736226 20:45363452-45363474 CCCCGCCCGGGAGGAGGGACTGG - Intronic
1174037609 20:47677901-47677923 GCTCGCCTGGCTGGAGCCTCTGG + Intronic
1174196234 20:48774738-48774760 ACCCGCACGGCTGAAACCACTGG + Intronic
1175121097 20:56716927-56716949 CCTCTCCCTGCTGGAGCCCCAGG + Intergenic
1175251808 20:57614490-57614512 CCCCTACCGGCTGGAGCCCCAGG - Intronic
1175996203 20:62813305-62813327 CCCCGCCCGGCAGGACCTGCAGG + Exonic
1175996243 20:62813425-62813447 CCCCGCCCGGCAGGACCTGCAGG + Exonic
1175996264 20:62813485-62813507 CCCCGCCCGGCAGGACCTGCAGG + Exonic
1176111836 20:63414382-63414404 CCCCGGCAGGCTGTGGCCACAGG + Intronic
1176129041 20:63488481-63488503 CCCCGCCCGGCCAGAGCCCTGGG - Intronic
1176376199 21:6087965-6087987 CCACGCCCGGCTGGAGAGAGAGG - Intergenic
1177211422 21:18076753-18076775 CCCAGCAAGGGTGGAGCCACTGG + Intronic
1178454848 21:32739614-32739636 CCGCGCCCGGCCGTAACCACAGG - Intronic
1178491046 21:33052127-33052149 CCGGGGCCGGCTGGGGCCACAGG - Intergenic
1179166202 21:38937119-38937141 CCCCATCAGGCTGGTGCCACAGG + Intergenic
1179747276 21:43450279-43450301 CCACGCCCGGCTGGAGAGAGAGG + Intergenic
1179875148 21:44263226-44263248 CCGGGCAGGGCTGGAGCCACAGG + Intergenic
1180187312 21:46146026-46146048 CCACGCCCGTCTGCACCCACGGG + Intronic
1180190838 21:46161785-46161807 CCCCGCCCGCCTGGGTCCCCGGG + Intronic
1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG + Intergenic
1180933694 22:19610443-19610465 CCCCGCCCCACAGAAGCCACAGG - Intergenic
1181057714 22:20267904-20267926 CCGCGCCAGGCTGGGGCCGCTGG - Intronic
1181173391 22:21022772-21022794 CCCCACCCTGCTGGGGGCACTGG - Intronic
1183678494 22:39313113-39313135 CCTACCCCGGCTGGAGCCAAAGG + Intronic
1184017922 22:41800030-41800052 TCCCGCCCGGCAGGGGCCCCGGG + Intergenic
1184594438 22:45505254-45505276 CGCTGCCCGGCTGCAGCCAGAGG - Intronic
1184865713 22:47200893-47200915 CCCCGCCCCGCTGCAGCCACCGG - Intergenic
1185138669 22:49088344-49088366 CCCAGCCCGGCTGGAGACCCAGG - Intergenic
1185320060 22:50196480-50196502 CACCGGCCGGCTGGCACCACGGG - Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
951258787 3:20482208-20482230 CACAGCCAGGCTGGAGCCCCAGG - Intergenic
954766443 3:52921702-52921724 CACCCTCCAGCTGGAGCCACAGG + Exonic
957845061 3:85721558-85721580 GCCCGCCCTGCTGGAGCACCTGG - Intronic
962302008 3:134251078-134251100 ACGGGCCAGGCTGGAGCCACCGG + Intergenic
963133086 3:141876464-141876486 CCCCGCCCCGCAGTAGCCTCGGG - Intronic
966516018 3:180821514-180821536 CCAGGCCAGGATGGAGCCACTGG - Intronic
967009499 3:185418807-185418829 CTCAGCCCGGCTGCTGCCACAGG + Intronic
968066535 3:195762351-195762373 CCCCTCCCGGCTTCAGCCCCAGG - Intronic
968357564 3:198121061-198121083 CCGAGCCCTCCTGGAGCCACTGG - Intergenic
968478896 4:825467-825489 CCCCGCGCCGCGGGAGCCAGGGG - Intronic
968830635 4:2931575-2931597 CCCCGCCAGGGTGGATCCGCCGG + Exonic
969366012 4:6694624-6694646 CCCTGCCAGGGAGGAGCCACCGG + Intronic
969577305 4:8043888-8043910 TGCCGCCCGCCTGGAGCCTCTGG - Intronic
972725866 4:41746078-41746100 CCCAGCCCGGCTGGAGCTCCGGG - Exonic
974029295 4:56761906-56761928 CCCCTTCTGGCTGGGGCCACAGG - Intergenic
978620733 4:110632705-110632727 CTCCTCCCGGCTGGAACCGCCGG - Intronic
982678827 4:158406061-158406083 CCACGCCCGGCTGAAGACATGGG + Intronic
984296574 4:177861737-177861759 CTCCGCCCGGGAGCAGCCACTGG - Intronic
984792278 4:183625816-183625838 CCTGGCCCAGCTGGAGTCACAGG + Intergenic
985207162 4:187550859-187550881 CCCCGCCCGGTTGGAGGAACTGG - Intergenic
985546411 5:511676-511698 CCCAGCACTGCTGGAGGCACAGG + Intronic
985783611 5:1883057-1883079 CCCCTCCCGGCCTGAGCCGCCGG - Intronic
987193269 5:15500460-15500482 CCGGCCCCGCCTGGAGCCACCGG + Exonic
988491843 5:31711763-31711785 CCTCGCCCTGCTCCAGCCACGGG - Intronic
991270533 5:64773782-64773804 CCCCTCCCTGCTGGGCCCACAGG - Intronic
997827079 5:137116091-137116113 CCCAGCCCAGCTGGTGCCAAGGG + Intronic
998167575 5:139852921-139852943 CCACCCCCGGCTGGACCCAGAGG - Exonic
999164019 5:149532301-149532323 CTCCGCCCGGCTGAAATCACAGG - Intronic
1001172491 5:169433521-169433543 CCCAGCCTGTCTGGAGCCCCTGG - Intergenic
1001683878 5:173578030-173578052 CCCCGCCAGGGTGGAGCCCATGG + Intergenic
1002710002 5:181189642-181189664 GCCCGCCCAGCTCGAGCCTCAGG - Intergenic
1002935691 6:1670165-1670187 CCCCGAGCTGCTGGTGCCACAGG - Intronic
1004194197 6:13488655-13488677 CCCCGCACCTCTGGAGCCATGGG + Intergenic
1006020706 6:31116139-31116161 TCCAGCACTGCTGGAGCCACAGG + Exonic
1006679430 6:35786862-35786884 CCCTGCCTGGCAGGAGCCAGAGG + Intronic
1006679494 6:35787129-35787151 CGCCGCCCGGGGGGAGCCAGAGG + Intronic
1007406216 6:41637682-41637704 CGCCGCCCGGCTGGCCCCACCGG + Intronic
1007783115 6:44265348-44265370 CCCCGGCCGGCCAGAGCCGCGGG - Exonic
1018859279 6:167699074-167699096 CTCCCCCCAGCTGCAGCCACAGG + Intergenic
1019042462 6:169118464-169118486 CCCCTCCCGGCTGGAGGGCCTGG + Intergenic
1019159795 6:170062352-170062374 CCCCCCTCTGCTGGAGCCATAGG + Intergenic
1019196637 6:170287015-170287037 CCCTGCCCTGCGGGAGCCTCTGG - Intronic
1020130285 7:5555532-5555554 CGTAGCCCGGCTGGGGCCACGGG + Intronic
1020347798 7:7183252-7183274 CCCAGTCCGGCGGGACCCACAGG - Intronic
1020383010 7:7566834-7566856 CCCCGCCCGGGAGGCGCCTCGGG - Intergenic
1022375349 7:29806821-29806843 CCCCGCCGGGCTGCAGCCCCGGG + Intronic
1023216816 7:37871276-37871298 CCCCACCCTTCTGCAGCCACTGG - Intronic
1028345821 7:89780450-89780472 CCCCGCCTGGATGCTGCCACAGG + Intergenic
1028754445 7:94419522-94419544 CCTGGTCCTGCTGGAGCCACAGG + Exonic
1032089365 7:128903690-128903712 CCCCTCCCTGGTAGAGCCACAGG - Intronic
1032187351 7:129738323-129738345 CCCAGCTCAGCTGGAGCCACAGG - Intronic
1035113914 7:156506808-156506830 TCCCGCCCCGCTGCTGCCACAGG - Intergenic
1035423595 7:158750863-158750885 TCCCCTCGGGCTGGAGCCACAGG + Intronic
1039552072 8:38450572-38450594 CCCCTCCGTGCTGGGGCCACAGG + Intronic
1040567748 8:48582471-48582493 GCTCGCCAGGCTGGAGCCAGCGG + Intergenic
1042785168 8:72537703-72537725 CCCCGGCTGGCTGGAGCTCCCGG - Exonic
1043469004 8:80543611-80543633 CCCAGACCTGCTGGACCCACTGG + Intergenic
1045264515 8:100607928-100607950 GCCCACCCAGCTGGAGCCAATGG + Intronic
1045847691 8:106657600-106657622 CCCCACCCGCCTGGCGCCAATGG - Intronic
1047429539 8:124779130-124779152 TCCCGAGCAGCTGGAGCCACAGG - Intergenic
1049364113 8:142228362-142228384 CCCTGCCCGGCTGCAGCCCAGGG + Intronic
1049412777 8:142480876-142480898 CCCTGCCTGGCTGCATCCACAGG - Intronic
1050475305 9:6034648-6034670 CACAGCCAGGCTGGAGCCCCAGG - Intergenic
1052122778 9:24738630-24738652 GCCGGCACGGCTGGAGGCACCGG - Intergenic
1053066286 9:35071890-35071912 CCGGGCCCGGCTGGGGCCTCGGG + Intronic
1055454421 9:76459402-76459424 CCCAGCCCGCCCGGGGCCACGGG - Intronic
1057497146 9:95570322-95570344 CTTCGCCGGGCTGCAGCCACAGG - Intergenic
1057571900 9:96210879-96210901 CCCCGCCCTCCTGCAGGCACGGG - Intergenic
1059414621 9:114155412-114155434 CCCCTGCCGGCCGGAGCCAAGGG - Intergenic
1060187902 9:121575043-121575065 CCCCGCCCTGCTCCAGGCACAGG - Intronic
1061065979 9:128277642-128277664 CCCTGCCCTCCAGGAGCCACAGG + Intronic
1061281000 9:129597586-129597608 CTGCGCCCGGCTGCAGCCGCGGG - Intergenic
1061295643 9:129675439-129675461 CCCTGCTGAGCTGGAGCCACTGG + Intronic
1062108921 9:134771416-134771438 CCCCTCCCAGCTGGAGCAGCGGG + Intronic
1062230772 9:135480244-135480266 CCCCGCGCTCCTGGAGCCCCAGG + Intronic
1062346955 9:136119285-136119307 CCCCGCCCTCCTGGAGCCTGGGG - Intergenic
1062364472 9:136202313-136202335 CCCGGGCCAGCTGGAGCCGCAGG - Intronic
1062409703 9:136417130-136417152 CCCAGGCCGGCTGGACCCCCAGG - Exonic
1062597370 9:137305359-137305381 TCCCGGCGGGCAGGAGCCACCGG - Intergenic
1187353299 X:18542301-18542323 CCCCGCCAGGCTGGTGTCAGTGG - Intronic
1189332836 X:40153787-40153809 CCCCGCGCGGCCGGAGGCTCGGG + Intronic
1189534406 X:41922755-41922777 CCCCGCCTGGCAGGAGCTCCAGG + Intronic
1189664929 X:43343796-43343818 CCACGCCCAGCTGGGTCCACTGG + Intergenic
1190526415 X:51333094-51333116 CCCCGCCCGGCACGATCCAGCGG - Exonic
1190542822 X:51496294-51496316 CCCCGCCCGGCACGATCCAGCGG + Exonic
1192363273 X:70452453-70452475 CCCCGCCCCGCTGGCGGCAGCGG + Intronic
1195018034 X:100797821-100797843 CCATGGCAGGCTGGAGCCACTGG - Intergenic