ID: 1157584261

View in Genome Browser
Species Human (GRCh38)
Location 18:48791127-48791149
Sequence GTTGACACCAGGCCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157584247_1157584261 18 Left 1157584247 18:48791086-48791108 CCCTGTACAAGCCCTACACTGTG 0: 1
1: 0
2: 0
3: 14
4: 92
Right 1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1157584251_1157584261 7 Left 1157584251 18:48791097-48791119 CCCTACACTGTGGCTCAGGCCCA 0: 1
1: 0
2: 1
3: 57
4: 1111
Right 1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1157584248_1157584261 17 Left 1157584248 18:48791087-48791109 CCTGTACAAGCCCTACACTGTGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1157584252_1157584261 6 Left 1157584252 18:48791098-48791120 CCTACACTGTGGCTCAGGCCCAG 0: 1
1: 0
2: 3
3: 36
4: 354
Right 1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157584261 Original CRISPR GTTGACACCAGGCCAAAGGA GGG Intronic
900581945 1:3413780-3413802 AGAGCCACCAGGCCAAAGGAGGG + Intronic
901534637 1:9874235-9874257 CTTTACACCAAGACAAAGGATGG - Intronic
902113721 1:14104069-14104091 ATTGGCACCATGCCAAAGGAAGG + Intergenic
903197252 1:21699949-21699971 GTTGACAACAGGGTAAAGGGCGG + Intronic
904970087 1:34412738-34412760 GTTGCCACAAGACCGAAGGAGGG - Intergenic
906874613 1:49523658-49523680 GTTGACATCAGTCAAATGGAAGG - Intronic
908490430 1:64638125-64638147 GTTGACCTCAGGCCCAAAGATGG + Intronic
920161037 1:203997719-203997741 GTGGCCATCAGGCCTAAGGAAGG - Intergenic
921600881 1:217105166-217105188 GTCACCACAAGGCCAAAGGAAGG - Intronic
921813664 1:219543028-219543050 GATGACATCAGGCCCAGGGAAGG + Intergenic
922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG + Intronic
1063138408 10:3236621-3236643 GATAATACCAGGACAAAGGAAGG - Intergenic
1065329816 10:24584292-24584314 GATGAAACCAGCCCAAATGAAGG + Exonic
1066038182 10:31515941-31515963 GTTGAAATCAGGGCAGAGGAAGG + Intronic
1067271104 10:44791946-44791968 TCTTAAACCAGGCCAAAGGATGG + Intergenic
1067713415 10:48668347-48668369 GATGACATCAGGCCCAGGGAAGG - Intergenic
1068073398 10:52224002-52224024 GTTGAAAACAGGCAATAGGAAGG - Intronic
1070045317 10:72828511-72828533 TTAGACATCAGGCTAAAGGAAGG - Intronic
1070457793 10:76634062-76634084 CTTGACACCAGGAAATAGGAAGG + Intergenic
1072431753 10:95378562-95378584 GATGACACCAAGCTAAAGCAGGG + Intronic
1076301266 10:129428510-129428532 GGGGACACCAGGCCACTGGAGGG + Intergenic
1078063140 11:8061193-8061215 GCTGATGCCAGGCCCAAGGAAGG - Intronic
1078551794 11:12286189-12286211 CTTGGAACCAGGCCAAGGGAGGG + Intronic
1081763721 11:45594713-45594735 GCCGACCCCAGGCCAGAGGACGG - Intergenic
1084307551 11:68296927-68296949 GGTGACAGCAGGCCCAGGGAGGG + Intergenic
1084982655 11:72839486-72839508 GTTGACAATAGCCCAAACGAGGG + Intronic
1085758545 11:79221948-79221970 GTGGAAACCAGGCCAGAAGAAGG - Intronic
1086951001 11:92890324-92890346 GTTGTCCGCAGGCCAAAGCATGG + Intronic
1091102476 11:132887927-132887949 GTTGAGGCCAGGCCAAGGGCTGG + Intronic
1093652389 12:21660175-21660197 GTTGACAACAGCCCACAGGCTGG - Intronic
1100791299 12:98133115-98133137 GTTTACAACAGTCCAAGGGAAGG - Intergenic
1103176567 12:118868949-118868971 GTTGTCTCCAGGGAAAAGGAAGG - Intergenic
1103846187 12:123903359-123903381 CTTGAACCCAGGCCAAGGGAAGG + Intronic
1104755500 12:131266776-131266798 GTGGACAGCAGGCCCAAGGAAGG + Intergenic
1108423191 13:50271495-50271517 GTTGAGTCCAGGCCAGAGGTAGG + Intronic
1111757718 13:92419938-92419960 TTTGACAGCAGGTCAAAGGTAGG - Intronic
1113272274 13:108686503-108686525 GATGACACCAGGCCAGAACAGGG + Intronic
1113524664 13:110965695-110965717 GTGCACACCTGGACAAAGGAGGG - Intergenic
1113924882 13:113935850-113935872 GCTGACACTAGGCCCAAGCATGG - Intergenic
1114205261 14:20564842-20564864 GTTGTTTCCAGGCCAGAGGAGGG - Intergenic
1115344574 14:32328589-32328611 GTTCCCTGCAGGCCAAAGGAAGG + Intergenic
1118057617 14:62097629-62097651 GAAGACACCAGACAAAAGGAAGG - Intronic
1121266013 14:92603100-92603122 GTGGAGACCAGGGCTAAGGAGGG + Intronic
1123433125 15:20235154-20235176 CTTTACACCAGGCCAAGGAAGGG - Intergenic
1123510048 15:20989474-20989496 GTTGACAGCAGACAAAGGGAGGG + Intergenic
1123567264 15:21563226-21563248 GTTGACAGCAGACAAAGGGAGGG + Intergenic
1123603527 15:22000519-22000541 GTTGACAGCAGACAAAGGGAGGG + Intergenic
1131315065 15:91328774-91328796 GTTGACTCAAGGCCAAGGGAAGG + Intergenic
1202975628 15_KI270727v1_random:290320-290342 GTTGACAGCAGACAAAAGGAGGG + Intergenic
1133769953 16:8861957-8861979 CTTGACTCCAGGAGAAAGGAGGG - Intronic
1134009388 16:10840265-10840287 GATGAAACCAGCCCAAATGAAGG + Intergenic
1134060227 16:11195039-11195061 GCAGACCCCAGGCCAAGGGAGGG + Intergenic
1135566157 16:23512640-23512662 GTTCAAACCAGTCCAAAGAATGG - Intronic
1136172907 16:28499071-28499093 GCTGCATCCAGGCCAAAGGAAGG + Intergenic
1136851501 16:33615969-33615991 CTTTACACCAGGCCAAGGAAGGG + Intergenic
1203113104 16_KI270728v1_random:1464432-1464454 CTTTACACCAGGCCAAGGAAGGG + Intergenic
1145101500 17:20081256-20081278 GTAGGCACCAGGACACAGGATGG - Intronic
1147631628 17:41936030-41936052 TTTGACACCAGGCTAAAGACAGG - Intronic
1148243812 17:46017233-46017255 CTTGACACCATGCCCAAGCATGG - Intronic
1148863922 17:50618893-50618915 CTCGACCCCAGGCCAGAGGAAGG - Exonic
1151966469 17:77434177-77434199 GCAGACAGCAGGCCAAAGCAAGG - Intronic
1152852268 17:82644375-82644397 GTGGACACCAGGTGAAGGGAAGG + Intronic
1152944209 17:83190339-83190361 GTGGACAGAAGGACAAAGGAAGG - Intergenic
1153258927 18:3202033-3202055 CTTGACAACAGTGCAAAGGAGGG + Intronic
1155190566 18:23425806-23425828 TTGGACATAAGGCCAAAGGAAGG + Intronic
1155308058 18:24498525-24498547 GTTGATACAAGGCCAAATGATGG + Intergenic
1155577142 18:27260001-27260023 GTTGCCTCCAGCCCAAAGGCCGG + Intergenic
1156051637 18:32943169-32943191 TTTGACAACATGCCAAATGATGG + Intronic
1156663031 18:39370723-39370745 GTAGCCACCAGGACCAAGGAAGG + Intergenic
1157293906 18:46428108-46428130 TTTAACACCAGGCCAAGGGGAGG + Intronic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1159479252 18:68966576-68966598 GTTGATCCAAAGCCAAAGGATGG - Intronic
1160333780 18:78018637-78018659 GTTGTCCCCAGGCCAGAGGACGG + Intergenic
1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG + Intronic
1166527995 19:43525536-43525558 ATTGCAACCAGGCCGAAGGAGGG - Intronic
1167780361 19:51594908-51594930 GTTGTAACCAGGACAGAGGAGGG - Intergenic
932284181 2:70518713-70518735 GTGGTCACCAGGCCAATGGGTGG - Intronic
943699750 2:190976839-190976861 TATTACTCCAGGCCAAAGGAAGG - Exonic
946978726 2:225182974-225182996 ATTGACACCAAGGAAAAGGAAGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948627181 2:239276376-239276398 CTGGACCCCAGGCCACAGGACGG + Intronic
948794954 2:240397749-240397771 GGTGGCAGCAGGCCAAAGGTGGG - Intergenic
1170850893 20:20003569-20003591 GTTGAACGCCGGCCAAAGGAAGG + Intergenic
1170979198 20:21195394-21195416 GTTGTCACCATTCCTAAGGATGG + Intronic
1171900673 20:30853426-30853448 TTTGACCCCACACCAAAGGAAGG + Intergenic
1172272179 20:33660769-33660791 GTTGACACAAGGCAAAATAATGG + Intronic
1173367125 20:42396413-42396435 GCTGACAACAAGCTAAAGGAAGG - Intronic
1174057334 20:47807074-47807096 GTAGACACCAGGACAAAGTCAGG + Intergenic
1174586459 20:51612369-51612391 GTAGAAAGGAGGCCAAAGGAGGG - Intronic
1178451478 21:32705395-32705417 GTTGATTCCAGGGCAAAGGCAGG + Intronic
1178585315 21:33866451-33866473 GCTGACACCAGCCCAGAGCAGGG + Intronic
1179616500 21:42586704-42586726 GAAGCCACCAGGCCACAGGAGGG + Intergenic
1179885711 21:44313455-44313477 GTCGAAACCAGCCCAAAGGCTGG + Intronic
1180057289 21:45365468-45365490 GTTTACACCAGGCCTTGGGAGGG + Intergenic
1180598046 22:16992164-16992186 GTTTCCTCCAGGCCTAAGGAAGG + Exonic
1183903111 22:41021193-41021215 GGTGACACCTGGCCCCAGGAGGG + Intergenic
1184975151 22:48056422-48056444 ATTGACACCAGGCCAGGGAAGGG + Intergenic
949754334 3:7392089-7392111 GTTCAAACCACACCAAAGGAGGG - Intronic
951602334 3:24390128-24390150 GATGACAACATGCCAGAGGAAGG + Intronic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
954805449 3:53217351-53217373 GGGGACACCAGGACAAAAGAGGG + Intergenic
959266201 3:104142091-104142113 GCTGACACCAGACCAAATTAAGG + Intergenic
961550376 3:127667512-127667534 GTGGCCACAGGGCCAAAGGAGGG + Intronic
962677636 3:137768517-137768539 GTTGGGACCAGGTCTAAGGAGGG - Intergenic
963940978 3:151096110-151096132 GTTGCCACAAGGCCATAAGATGG - Intronic
969951107 4:10836490-10836512 GATATCACCAGGCCAAAGGAAGG - Intergenic
972855899 4:43106341-43106363 GTTGTCACCTGCCCAAAGGGTGG + Intergenic
975406034 4:73991097-73991119 GTTGATACCAGGAAAAAGGTAGG + Intergenic
980656292 4:135791693-135791715 ATTGACTCCAGACCATAGGAAGG - Intergenic
981074364 4:140576777-140576799 GTGGAGATCATGCCAAAGGATGG - Intergenic
981078896 4:140618636-140618658 GATGACACCAGTGCAGAGGAAGG - Intergenic
995798337 5:115963794-115963816 GTTGAAAACTGGCCAGAGGAAGG - Intronic
995800710 5:115990978-115991000 GTTGACAACAGGAGAAAGGAGGG - Intronic
997625468 5:135327976-135327998 GTTGGCACCAGGCCACAGCTCGG - Intronic
997976396 5:138444100-138444122 GTTGACCCTAGGGCAGAGGAAGG + Intronic
1001031474 5:168266430-168266452 GTTCACACCAGGCCAGAAGCCGG + Intergenic
1001982549 5:176046852-176046874 GTTGACATCAGGCCTCAGGAGGG + Intergenic
1002234912 5:177797205-177797227 GTTGACATCAGGCCTCAGGAGGG - Intergenic
1004586602 6:17008007-17008029 GTTGACATCAGGGAAAAGGAAGG + Intergenic
1008836396 6:55836708-55836730 GTTGGCACCAGTCTAAAGGCTGG - Intronic
1010790887 6:80064165-80064187 GATGAAACCAGCCCAAATGAAGG + Intergenic
1011979771 6:93358636-93358658 GTTGGCACCAGGCCAAAGTCTGG + Intronic
1016654252 6:146499740-146499762 ATTGAAACCAAGGCAAAGGAAGG - Intergenic
1018659409 6:166072223-166072245 GTGGAAACTAAGCCAAAGGAGGG - Intergenic
1022374102 7:29797368-29797390 CTTGCCACCATGCCACAGGATGG - Intergenic
1036201730 8:6776031-6776053 GGTGACATCAGGGTAAAGGATGG + Intergenic
1037673657 8:21036700-21036722 CTTGTCCCCAGGCCAGAGGATGG - Intergenic
1040386826 8:46919784-46919806 GATGGCAGCAGGGCAAAGGAAGG - Intergenic
1043137184 8:76542806-76542828 GTAGAAAGCAGGCCAAAGAAAGG - Intergenic
1048082764 8:131147230-131147252 GTTGACATCAGTCCAAAAGTGGG - Intergenic
1049180363 8:141219061-141219083 GGTGGCACCAGGCCACAGGGGGG + Intronic
1051349123 9:16182670-16182692 GTTAACCCCAGGCCTCAGGAAGG - Intergenic
1057228012 9:93302625-93302647 GTTGAGGCCAGGCCAGAGGATGG + Intronic
1057522633 9:95772188-95772210 CTGGACACTAGGCCACAGGAGGG + Intergenic
1059220920 9:112618047-112618069 GTTGATGCCAGGCAGAAGGATGG + Intronic
1060102533 9:120853169-120853191 CTTGACACCAGGGAAGAGGAAGG - Intergenic
1060562620 9:124559009-124559031 GCTGGTACCAGGCCAAAGCAAGG + Intronic
1060617049 9:125026590-125026612 GATGTCACAATGCCAAAGGAGGG - Intronic
1187003268 X:15204522-15204544 GGTGACACCAGGCCAAGCAAAGG - Intergenic
1187755507 X:22521224-22521246 GGTGACAGCAGGAAAAAGGAAGG + Intergenic
1199304515 X:146251710-146251732 GAAGAAAGCAGGCCAAAGGAAGG + Intergenic