ID: 1157584947

View in Genome Browser
Species Human (GRCh38)
Location 18:48794924-48794946
Sequence TTGCATGGATAGATGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157584947 Original CRISPR TTGCATGGATAGATGGGTCA GGG Intronic
900498173 1:2986042-2986064 ATGGATGGATGGATGGGTGATGG - Intergenic
900930930 1:5737047-5737069 ATGGATGGATGGATGGGTGATGG + Intergenic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
903294278 1:22333730-22333752 ATGGATGGATGGATGGGTGATGG + Intergenic
903294297 1:22333824-22333846 ATGGATGGATGGATGGGTGACGG + Intergenic
903562946 1:24242429-24242451 TTGCATGTATAAATAGCTCACGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
908392180 1:63693567-63693589 TTGGATGGACAGTTGGGTGATGG + Intergenic
908755959 1:67468932-67468954 TCGCATGGATAGTTGAGTCTAGG - Intergenic
910151165 1:84148809-84148831 TTGCATTGCTAAATGGCTCATGG - Intronic
911606398 1:99910134-99910156 TTGCATGGATATATTGGGTAAGG + Intronic
914351301 1:146842755-146842777 ATGCATGGATGGATGGATGATGG + Intergenic
918670551 1:187210356-187210378 TTGGAAGGATAGATCAGTCAAGG - Intergenic
920542328 1:206788475-206788497 CTGCATGGAGATATGGGTAAAGG - Intergenic
922343261 1:224674579-224674601 TTCCATGGATAGTTGCTTCATGG + Intronic
922745786 1:228042861-228042883 GTGGATGGATAGATGGGTGGTGG + Intronic
923117677 1:230958698-230958720 TTGCTTAGATAGACGGGGCATGG + Intronic
923971812 1:239211477-239211499 TTGCAGTGATAGATGCTTCATGG - Intergenic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1063981494 10:11455664-11455686 TTGAATCTATAGATGAGTCAAGG - Intronic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1074992239 10:118719441-118719463 TGCCATGGACAGATGTGTCATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1078266817 11:9761013-9761035 TTATATGGATCGATGGGTGATGG + Intergenic
1079442581 11:20530016-20530038 TTTCATGGAGGGATGAGTCAGGG - Intergenic
1081505303 11:43710172-43710194 TTGTAAGGATAGTTGGCTCAGGG - Intronic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084684561 11:70686099-70686121 ATGGATGGGTAGATGGGTGATGG - Intronic
1085713168 11:78848585-78848607 TTGCCTAGCTGGATGGGTCAAGG - Intronic
1087344204 11:96949930-96949952 TGGCAGGGATAGACGGGTCAGGG - Intergenic
1087710355 11:101542175-101542197 TTTCAAGGATAGATGAGACACGG + Intronic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1090857097 11:130619713-130619735 TTGGATGGATAGATGGATGGAGG - Intergenic
1092777880 12:11959913-11959935 TTCCAAGCAGAGATGGGTCATGG - Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1097978493 12:65712809-65712831 TTGCATGGATAGAGAAATCAAGG - Intergenic
1100451728 12:94713016-94713038 TTGCTTTGATTGATGGGTCCTGG - Intergenic
1103914669 12:124370098-124370120 GTGCCTGGATAGCGGGGTCAGGG - Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104763962 12:131314548-131314570 ATGGATGGATAGATGGCTGATGG - Intergenic
1106571944 13:30935073-30935095 CTGCAGGGATGGATGGGTGAAGG - Intronic
1110183796 13:72648904-72648926 ATGCTTGGAAAGATGGGTTAGGG - Intergenic
1111850692 13:93570159-93570181 TTGCAAGGATATATGGTTAATGG - Intronic
1112810860 13:103216960-103216982 ATGGGTGGATAGATGGGTCGGGG - Intergenic
1113037214 13:106063167-106063189 TTGAATGGATGGATGGCTGAAGG + Intergenic
1113240232 13:108328820-108328842 TTGCATGGGGAGCTGGGTGAGGG + Intergenic
1114650226 14:24280038-24280060 TTGGATGGATGAATGGGACAGGG - Intergenic
1115949416 14:38703224-38703246 TTATTTGGATAAATGGGTCAGGG - Intergenic
1118851637 14:69588255-69588277 TTGGATGGATGGATGGATGATGG - Intergenic
1120433183 14:84445124-84445146 TTGCATGGCCAGATGAATCAAGG - Intergenic
1121096547 14:91221432-91221454 ATGCATGGATGGATGGGTGATGG + Intronic
1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG + Intergenic
1132138083 15:99364025-99364047 TGGCATGGAAAGAGGGGTAATGG - Intronic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1132934179 16:2472678-2472700 CTGCAGGGAGGGATGGGTCAGGG - Intronic
1134819986 16:17239278-17239300 GTGGATGGATGGATGGATCATGG - Intronic
1135980324 16:27142175-27142197 GTGCATTGCTAGATGGGTCGGGG - Intergenic
1139663045 16:68435245-68435267 TTGCCTAGAAAGGTGGGTCAGGG + Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140182710 16:72736298-72736320 TGGCAAGGAGGGATGGGTCAGGG + Intergenic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1141899351 16:86980543-86980565 ATGCATGGATAGATGGATGTGGG + Intergenic
1142128621 16:88422263-88422285 GTGGATGGATAGGTGGGTAATGG + Intergenic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1144100708 17:11939888-11939910 ATGGATGGATGGATGGGTGATGG + Intronic
1145016832 17:19404425-19404447 ATGCATGGATAGATGGTTGGAGG + Intergenic
1145262425 17:21362479-21362501 ATGCATGGATGGATGGATGATGG + Intergenic
1145271569 17:21407568-21407590 GTGGATGGATGGATGGGTAATGG - Intronic
1146295355 17:31645595-31645617 TTCCATGCAGGGATGGGTCAGGG + Intergenic
1148388340 17:47252806-47252828 TGGGCTGGAGAGATGGGTCAGGG + Intergenic
1149436934 17:56640924-56640946 ATGGGTCGATAGATGGGTCAGGG + Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1156399373 18:36727000-36727022 ATGGATGGATGGATGGGTTAGGG + Intronic
1157177590 18:45465569-45465591 ATGCATGGATGGATGGATGAAGG - Intronic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1157641846 18:49223682-49223704 TTGCCTGAATAGATAGGTAAGGG + Intronic
1158613050 18:58960742-58960764 TTGCATGGATAGCTGACTCATGG + Intronic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161372876 19:3923566-3923588 ATGGATGGATGGATGGGTGAAGG + Intronic
1161498950 19:4602759-4602781 GTGCATGGATATATGGATTATGG + Intergenic
1161632895 19:5367876-5367898 ATGAATGGATGGATGGGTTACGG + Intergenic
1161977334 19:7613682-7613704 TTGCATGGGTGGGTGGGTGATGG + Intronic
1162085858 19:8248753-8248775 TTGGATGGATGGATGGATGATGG + Intronic
1164701351 19:30287219-30287241 ATGGATGGATAGATGGGTGGAGG + Intronic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1165804631 19:38572912-38572934 GTGCATAGATAGAGGGGTCAGGG - Intronic
1167168928 19:47818205-47818227 ATGGATGGATGGATGGGTGATGG - Intronic
1167168938 19:47818240-47818262 ATGGATGGATGGATGGGTGATGG - Intronic
1167168947 19:47818275-47818297 ATGGATGGATGGATGGGTGATGG - Intronic
1167168956 19:47818306-47818328 ATGGATGGATGGATGGGTGATGG - Intronic
1167837627 19:52087260-52087282 TTACATAGGTAAATGGGTCATGG + Intronic
1168414295 19:56158981-56159003 ATGGATGGATGGGTGGGTCATGG - Intronic
1168593444 19:57654973-57654995 TTGGATGGATAGATAGGTTAAGG - Intergenic
925045956 2:773417-773439 TTGCATGAAAGGATGGGTCTTGG + Intergenic
925239435 2:2310925-2310947 TTGGTTGGATAGTTGGGTAAAGG - Intronic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
926223254 2:10949970-10949992 ATGGATGGATGGATGGGTAAAGG + Intergenic
926544031 2:14216744-14216766 TTGCTTTGGTAGATAGGTCATGG - Intergenic
926912247 2:17862000-17862022 ATGGATGGATGGATGGGTGAAGG + Intergenic
932803156 2:74760760-74760782 TTGCATGGAAAGATAGGTTTTGG + Intergenic
932822602 2:74914372-74914394 TTGCATAGGTAGTTGAGTCATGG + Intergenic
939423827 2:142008448-142008470 TTCTCTGGATACATGGGTCAAGG + Intronic
939600880 2:144188563-144188585 ATGGATGGATGGATGGGTGATGG + Intronic
940343931 2:152610093-152610115 TTATATGGAAAGATGGGTCAAGG + Intronic
944130193 2:196339269-196339291 TTGCCAGAATAGATGTGTCATGG - Intronic
945992673 2:216409185-216409207 ATGCATTGATAGATGATTCATGG - Intergenic
946239598 2:218345514-218345536 TTGCAGGGATGGGTGGGGCAGGG - Exonic
946255668 2:218440077-218440099 TGGCATGTATAGATAGGTCAAGG + Intronic
947812846 2:233015167-233015189 GTGGATGGATGGATGGGTGAAGG - Intronic
1169637896 20:7714968-7714990 GTGGATGGATAGATGGGTGGAGG + Intergenic
1170348610 20:15415770-15415792 TTGCATGGATATATGGATGATGG - Intronic
1172615488 20:36280691-36280713 ATAAATGGATAGATGGGTGATGG - Intergenic
1173556239 20:43968065-43968087 GTGAATGAATAGATGGGTGAGGG - Intronic
1174512086 20:51061084-51061106 ATGGATGGATGGATGGGTGATGG - Intergenic
1175165282 20:57039176-57039198 TTGGATGGATGGATGGATGATGG + Intergenic
1175440796 20:58989827-58989849 TTGCAGGGAGAGAGGGGGCAGGG - Intronic
1175687992 20:61045277-61045299 ATGGATGGATAGATGGTTGATGG - Intergenic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175817421 20:61890599-61890621 ATGGATGGATGGATGGGTAAGGG + Intronic
1175818081 20:61893855-61893877 ATGGATGGATGGATGGGTGATGG + Intronic
1176134078 20:63512301-63512323 TTGTATTGATAGACGGGTGAGGG - Intergenic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1179125570 21:38587731-38587753 TTGCATGGATAAGTGGTTAAAGG + Intronic
1179804526 21:43828790-43828812 TTTTATGGAGAGATGGGGCATGG + Intergenic
1180024918 21:45155630-45155652 ATGCATGGAGAGATGGATGATGG - Intronic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180834633 22:18923691-18923713 TTGCTTGGAAAGAAGTGTCAGGG - Intronic
1181065255 22:20302820-20302842 TTGCTTGGAAAGAAGTGTCAGGG + Intergenic
1183266752 22:36831993-36832015 GTGCATGGATGGATGGATGACGG + Intergenic
1183303990 22:37072273-37072295 TTGCATGGATGGATGGATGATGG + Intronic
1183304009 22:37072368-37072390 GTGCATGGATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184460799 22:44636796-44636818 GTGGATGGTTAGATGGGTGATGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1185076636 22:48686745-48686767 TTGAATGGATAGATGGGTAGGGG + Intronic
1203284722 22_KI270734v1_random:148990-149012 TTGCTTGGAAAGAAGTGTCAGGG - Intergenic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
953070776 3:39517195-39517217 TTGCAGGGATGGTTGGGTAAGGG + Intronic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
955406477 3:58628927-58628949 TTGCTTGGCTGGAAGGGTCATGG - Intergenic
955532204 3:59885970-59885992 TTGCAAGGATAGGAGGGTTATGG + Intronic
955737494 3:62054932-62054954 TTCCATGGGGAAATGGGTCAGGG + Intronic
956082545 3:65573813-65573835 TGGCATGGTTAGCTGTGTCAGGG + Intronic
956350507 3:68330025-68330047 TTGCAGGGATAGCTGGGTCCAGG + Intronic
958457630 3:94351473-94351495 ATGCATGATTAGATGGGTAATGG - Intergenic
959783238 3:110261804-110261826 TTGCATGGATAAATTAGCCAAGG + Intergenic
960114812 3:113883544-113883566 TAAGATGGATAGATGGATCATGG - Intronic
960505864 3:118492797-118492819 GTGAATGGAAAGATGGGTGAGGG + Intergenic
960847255 3:122016024-122016046 GTGCATGGCTGCATGGGTCATGG - Intronic
963961636 3:151315526-151315548 TTGCAGGTATACATGGGTTAAGG - Intronic
967196678 3:187032464-187032486 TTGAATGAATAAATGGGTGACGG - Intronic
967426345 3:189331709-189331731 TTGCTTGGATAGAAAGGTCAGGG + Intergenic
968791994 4:2671566-2671588 TTGCATGAATAAATGTGTCGCGG + Intronic
969082395 4:4628936-4628958 TCGCATAGATATATGTGTCATGG + Intergenic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969571592 4:8012118-8012140 ATGGATGGATGGATGGGTGAAGG - Intronic
969571635 4:8012304-8012326 ATGGATGGATGGATGGGTGAAGG - Intronic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
973636157 4:52863109-52863131 TTGTCTGGAAAGAAGGGTCAAGG + Intronic
974090720 4:57307958-57307980 TTGGATGGATAAATGGTTGATGG - Intergenic
976324466 4:83755139-83755161 TTGAATGGAGGGATGGGTGAAGG - Intergenic
981114705 4:140976305-140976327 TGGCAAGGAGAGATGGGACAAGG - Intronic
982012367 4:151118671-151118693 TTACATGGCTAGAAGGGTAATGG - Intronic
983316907 4:166144047-166144069 TTGCATGGATACTTGGGGTAGGG - Intergenic
983770249 4:171540055-171540077 ATGGATGGATAGATAGGTAATGG - Intergenic
987243813 5:16028066-16028088 TTGCATCTATAGATTGTTCAGGG + Intergenic
987926978 5:24354167-24354189 TCACATGAATACATGGGTCAAGG - Intergenic
992904194 5:81329470-81329492 TTGTGTGAATAGATGGGTGAGGG + Intergenic
993818070 5:92577942-92577964 TTGCATGTATAGATGGCTCTGGG - Intergenic
996639137 5:125730917-125730939 TTGCTTGGTTAAATGGGTCCTGG + Intergenic
997811484 5:136974605-136974627 TTCCATGGATATAGGGGTGAGGG + Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746733 5:154598135-154598157 TTGGATGGATGGATGGGGGATGG + Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002298643 5:178245531-178245553 GTGAATGGATGGATGGGTGATGG - Intronic
1003430776 6:6035503-6035525 TTCCAGGGATAGAAGGATCAGGG + Intergenic
1006737427 6:36284508-36284530 TTGGATGGATGGATGGATAAAGG - Intronic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1010012149 6:71060509-71060531 TGGAATGGAGAGGTGGGTCAGGG + Intergenic
1010298476 6:74229775-74229797 TTCCATGGATATATGTGTGAAGG + Intergenic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1014426870 6:121317903-121317925 TTTCATGGTTACATGGATCAAGG + Intronic
1014673087 6:124330974-124330996 TTCCATGGACAGATGGGTGTGGG - Intronic
1018578833 6:165289482-165289504 TTACATGGATATATGTGTAATGG + Intronic
1019180474 6:170184448-170184470 TTGCATGGGGAGATGGGGCTGGG + Intergenic
1019480928 7:1266489-1266511 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019480938 7:1266536-1266558 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019914643 7:4124940-4124962 ATGGATGGATGGATGGGTGATGG + Intronic
1019914661 7:4125042-4125064 ATGGATGGATGGATGGGTAATGG + Intronic
1019914689 7:4125172-4125194 ATGGATGGATGGATGGGTGATGG + Intronic
1019914705 7:4125246-4125268 ATGAATGGATGGATGGGTGATGG + Intronic
1020717858 7:11699848-11699870 TTGCATGGATGGAAATGTCAGGG + Intronic
1022478401 7:30726952-30726974 TTGAATGGATTGATGTGACAGGG - Intronic
1023757221 7:43431192-43431214 GTGCAGGAATAGATGGCTCATGG - Intronic
1025105542 7:56168997-56169019 TTGGATGGAAAGATGGTTGAAGG - Intergenic
1025294876 7:57769350-57769372 TTGCAGGGAAGGTTGGGTCAGGG + Intergenic
1026128153 7:67597632-67597654 TTGAATAGATACATGGGACAGGG + Intergenic
1026244731 7:68609110-68609132 ATACATGGATAGATGGATAATGG + Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026314629 7:69217513-69217535 TTGAATGGAAAGATGGTTGAAGG - Intergenic
1026531329 7:71199802-71199824 TTGGATGGATGGATGGATGATGG - Intronic
1030196297 7:106856961-106856983 TCCCATGGTTAGATGGGTCATGG + Intergenic
1036946167 8:13097013-13097035 CTGTAAGGCTAGATGGGTCATGG - Intronic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1039015595 8:33145558-33145580 TTGAATGGATAGATGTGTATAGG + Intergenic
1039449693 8:37662261-37662283 GTGCATGGATAGATAGTTGATGG + Intergenic
1043996455 8:86823633-86823655 TGGGATGGAGAGAAGGGTCATGG + Intergenic
1046283410 8:112063339-112063361 TTGCAATCATAGATGGGTTATGG + Intergenic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1048187873 8:132260877-132260899 TTGGATGGATGGATGGATGATGG - Intronic
1048579802 8:135721553-135721575 TAGCATTGATAAATGGGCCATGG - Intergenic
1048617668 8:136095651-136095673 TTGCATTAATAGATGGATGATGG + Intergenic
1048972854 8:139654936-139654958 GTGAATGGAAAGATGGGTGACGG + Intronic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979769 8:139697020-139697042 GTGGATGGGTAGATGGGTGAAGG + Intronic
1049359841 8:142207227-142207249 GTGGATGGATAGATGGGGCTTGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049464118 8:142743412-142743434 ATGGATGGATAGATGGGTGGGGG + Intergenic
1049464261 8:142743913-142743935 ATGTATGGGTGGATGGGTCAGGG + Intergenic
1050587423 9:7127061-7127083 TTGGATGGATGGATGGGTGCAGG + Intergenic
1051707219 9:19893294-19893316 ATGCATGGATTGATGGGGAATGG - Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1053199991 9:36145772-36145794 TTGGATGGATGGATGGTTCGAGG + Intronic
1059070110 9:111126537-111126559 CTGCATAGATGGATGGGTAAAGG - Intergenic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1185750553 X:2607462-2607484 ATGGGTGGATAGATGGGTCTGGG - Intergenic
1185840504 X:3385246-3385268 ATGAATGGATAGATAGGTGATGG + Intergenic
1188836047 X:34955529-34955551 TAGCATGAATGGATGGGTCTTGG - Intergenic
1189853419 X:45199459-45199481 TTGAAGGGATATATGGGGCAGGG - Intronic
1193492508 X:82166510-82166532 TAGCATGGCTAGAGGGGTAAGGG - Intergenic
1195300887 X:103528775-103528797 TTGGAAGGATAGATAGCTCAGGG + Intergenic
1195373965 X:104207376-104207398 GTGCATGGATAGATTAATCAGGG + Intergenic
1199949109 X:152691729-152691751 CTGCCTGGATACCTGGGTCACGG + Intergenic
1199960567 X:152776720-152776742 CTGCCTGGATACCTGGGTCACGG - Intergenic
1200781948 Y:7224705-7224727 GTGAATGGATAGATGGGTGATGG - Intergenic