ID: 1157585480

View in Genome Browser
Species Human (GRCh38)
Location 18:48798370-48798392
Sequence GATGAACCCCAAACCGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157585480 Original CRISPR GATGAACCCCAAACCGAAGA GGG (reversed) Intronic
900228525 1:1544132-1544154 AATGAGCCTCAAACCGAAGGCGG + Intronic
900662964 1:3795134-3795156 GATGAAACCAAAAGAGAAGATGG + Intronic
905075569 1:35268337-35268359 GAAGAATCCCAAACCAATGAGGG - Intergenic
906434221 1:45781315-45781337 GAAGAAACCCAAAGCCAAGAAGG + Intergenic
906853781 1:49282597-49282619 GATGAACCCGATACCTCAGATGG - Intronic
907986127 1:59533082-59533104 GATGAACCCCGTACCTCAGACGG - Intronic
908499927 1:64733026-64733048 GATAAACCCCAAATCTAACAGGG + Intergenic
910381386 1:86630385-86630407 GATGAACCCAATACCTCAGATGG + Intergenic
918404695 1:184200213-184200235 GATGAAGCCTAAAAAGAAGAGGG - Intergenic
919375370 1:196786846-196786868 GATGAACCCAGAACCTCAGATGG + Intronic
924216911 1:241831970-241831992 GAAGAAACCCAAAGCCAAGAAGG + Intergenic
1064020900 10:11807978-11808000 GATGAAGCTCAAACCGATTATGG + Intergenic
1064237779 10:13592263-13592285 GAAGAAACCCAAAGCCAAGAAGG - Intronic
1064356445 10:14623134-14623156 GATGAACACCAAAAGAAAGAGGG - Intronic
1064901195 10:20297461-20297483 GATGAACCCGATACCTCAGATGG + Intergenic
1067212143 10:44268399-44268421 GATGAACCCGGAACCTCAGATGG - Intergenic
1077784894 11:5373428-5373450 GATGAACCCCATACCTCAGATGG - Intronic
1078843410 11:15100299-15100321 CCTGAAATCCAAACCGAAGAAGG - Intergenic
1080219133 11:29879952-29879974 GATGGAGCCCAAACTGAAGACGG - Intergenic
1080968924 11:37246606-37246628 GATGAACCCCGTACCTCAGATGG + Intergenic
1083803215 11:65058456-65058478 GATGATCCCCAGCCCCAAGAGGG + Exonic
1086870042 11:92026976-92026998 GATGAACCCGGAACCTCAGATGG - Intergenic
1089919612 11:122196102-122196124 TATGACCTCCAAACCGAAGTTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095227891 12:39699176-39699198 GATGAACCCAATACCTCAGATGG - Intronic
1095534297 12:43227816-43227838 GATGAACCCGATACCTCAGATGG - Intergenic
1098638567 12:72813594-72813616 GATGAACCCCATACCTCAGTTGG + Intergenic
1099548263 12:84011819-84011841 GATGAACCCCGTACCTCAGATGG + Intergenic
1109390668 13:61687653-61687675 AATGAACCCCAAAAAGAATAGGG + Intergenic
1110543947 13:76736093-76736115 TATGTACCCCAAAGTGAAGAGGG + Intergenic
1111004316 13:82229100-82229122 GATGAACCCGGTACCTAAGATGG - Intergenic
1113107188 13:106784293-106784315 GATGAACCCGGAACCTCAGATGG + Intergenic
1116042643 14:39703630-39703652 GATGAACCCCGTACCTTAGATGG + Intergenic
1116561952 14:46390892-46390914 CATAAACCCTAAACTGAAGATGG - Intergenic
1118374284 14:65163245-65163267 GATCAACCCCAAACAGGAAATGG - Intergenic
1119715684 14:76857436-76857458 GAGGAACCCCAAATCCAGGATGG + Exonic
1123790401 15:23714158-23714180 GATGAACCCCGTACCTCAGATGG - Intergenic
1124344037 15:28909487-28909509 GATGAACCACAAACAAAACATGG - Intronic
1126845119 15:52752582-52752604 AATAAACCCCAAATCAAAGAGGG + Intergenic
1136268576 16:29135015-29135037 GATGAAGCCCAAACCCCAGGTGG + Intergenic
1137041181 16:35614396-35614418 GATGAACCCCGTACCTCAGATGG + Intergenic
1141904115 16:87011820-87011842 GAAGAAATGCAAACCGAAGAAGG + Intergenic
1142071888 16:88095382-88095404 GATGAAGCCCAAACCCCAGGTGG + Intronic
1153105608 18:1522130-1522152 GATGAACCCCGTACCTCAGATGG + Intergenic
1153164547 18:2247256-2247278 GATGAACCCCGTACCTCAGATGG - Intergenic
1155675349 18:28422457-28422479 GATGAACCCGATACCTCAGATGG + Intergenic
1156206759 18:34894862-34894884 GATGAACCCGATACCTCAGATGG - Intergenic
1156722264 18:40084584-40084606 TATGAACCCCAACCTGAAGCCGG - Intergenic
1157585480 18:48798370-48798392 GATGAACCCCAAACCGAAGAGGG - Intronic
1159015374 18:63098150-63098172 GATGCACCCCCAACCCAAGGCGG + Intergenic
1159565585 18:70044700-70044722 GATGAATCACAAGACGAAGAAGG - Intronic
1160745131 19:707986-708008 GATGTACCCCAGGCTGAAGAAGG - Intergenic
925963210 2:9038418-9038440 GATGAACCCGATACCTCAGATGG - Intergenic
926075498 2:9939673-9939695 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
926075509 2:9939710-9939732 TCTGAAGCCCAAACCGAGGAGGG + Intergenic
928390279 2:30904286-30904308 GATGAACCCCGTACCTCAGATGG - Intergenic
935739112 2:106130982-106131004 GATGAACCCGGAACCTCAGATGG - Intronic
939051725 2:137315423-137315445 GATGAACCCGATACCTCAGATGG + Intronic
941053664 2:160762980-160763002 GATGAACCCGATACCTCAGATGG + Intergenic
941486744 2:166091476-166091498 AATGAACCTCAAACTGAATAAGG - Intronic
945382966 2:209163511-209163533 GATGAACCCGATACCTCAGATGG - Intergenic
947306669 2:228755783-228755805 GATGAACCCCGTACCTCAGATGG - Intergenic
1168806833 20:676526-676548 GTTGAACCCCAAACCCAACAGGG - Intergenic
1171068854 20:22046503-22046525 GATGAACCCCGTACCTCAGATGG + Intergenic
1172568285 20:35948328-35948350 GAGGAATTCCAAACCGAAGCAGG + Exonic
1174138272 20:48395340-48395362 AATGAACGCCGAACCGATGAAGG - Intergenic
1177025863 21:15920624-15920646 GATGAACCCCGTACCTCAGATGG + Intergenic
1185195764 22:49468387-49468409 GAGGAACCCGAACCCGTAGATGG + Intronic
955402823 3:58605479-58605501 GATGGAGCCCAAACAGAACATGG - Intronic
960171981 3:114472871-114472893 GATGGAAACCAAACCAAAGAGGG + Intronic
961174277 3:124821168-124821190 AATGAAACCCAACCCCAAGAAGG + Intronic
962397670 3:135031139-135031161 GATGAACCCCGTACCTCAGATGG + Intronic
964551653 3:157891246-157891268 GATGAAGCCAAAAGGGAAGATGG + Intergenic
967737231 3:192965542-192965564 GATGAACCCAATACCTCAGATGG + Intergenic
968474940 4:799961-799983 CATGAACCCCAACTCGAAGCCGG + Intronic
970984938 4:22146515-22146537 GATGAACCCCGTACCTCAGATGG - Intergenic
971331621 4:25686093-25686115 GATAAACTCCAAAGGGAAGACGG - Intergenic
974142015 4:57899695-57899717 GATGAACCCCATACCTCAGAAGG - Intergenic
976490793 4:85667540-85667562 GATGAACCCCGTACCTCAGATGG + Intronic
977975244 4:103256181-103256203 GATGAACCCCGTACCTCAGATGG + Intergenic
979624243 4:122827486-122827508 GGTGAACCCGAAACCGCCGAGGG - Intronic
979771034 4:124525227-124525249 GATGAACCCCAGGCCCTAGAGGG + Intergenic
981030825 4:140123959-140123981 AATGAACCCCAAAGCGACTAAGG + Intronic
982801813 4:159715454-159715476 GATGAACCCTGTACCGCAGATGG + Intergenic
989732827 5:44668590-44668612 GATGAACCCCGTACCTCAGATGG - Intergenic
989779185 5:45243892-45243914 GATGAACCCCGTACCTAAGTTGG + Intergenic
989817019 5:45749085-45749107 GATGAACCCCGTACCTCAGATGG + Intergenic
992410137 5:76497257-76497279 AATAAACTCCAAACCGCAGAAGG - Intronic
993624477 5:90208423-90208445 GATGAACCCGATACCTCAGATGG - Intergenic
995334696 5:110985826-110985848 GATGAACCCGATACCTCAGATGG - Intergenic
996550240 5:124722931-124722953 TACGACCCCCAAACCCAAGAAGG + Intronic
999844495 5:155463976-155463998 AATGTACTCCAAACAGAAGAAGG - Intergenic
1000522312 5:162310776-162310798 CTTGAAGCCCAAACCAAAGAAGG + Intergenic
1003457916 6:6300658-6300680 GATGAACCCCATACCTCAGATGG + Intronic
1008265267 6:49417501-49417523 GGTGAACCTGAAACAGAAGAGGG + Intergenic
1011387375 6:86812573-86812595 GATGAACCCGGTACCTAAGATGG + Intergenic
1014849681 6:126326687-126326709 GATGAACCCGGTACCTAAGATGG - Intergenic
1019538095 7:1539198-1539220 GACTAATCCCAAACCGAATAAGG + Exonic
1029915947 7:104209818-104209840 GATGAACCCAGTACCGCAGATGG - Intergenic
1032944199 7:136831278-136831300 GATGAACCCCGTACCTCAGATGG - Intergenic
1033665611 7:143437877-143437899 GAGGAGCCCCAAACTGAAAAAGG + Intergenic
1033830178 7:145241967-145241989 GATGAACCCGATACCTCAGATGG + Intergenic
1033880098 7:145870568-145870590 GATGAACATGAAACAGAAGATGG - Intergenic
1038747954 8:30270445-30270467 GATGAAGGCGAGACCGAAGAAGG - Intergenic
1040078723 8:43266489-43266511 GATGAACCCGATACCTCAGACGG + Intergenic
1041304618 8:56446672-56446694 AATTAGCCCCAAACCGAAGGAGG + Intronic
1043518195 8:81016148-81016170 GAAGAACCTCCAACCTAAGATGG + Intronic
1044047476 8:87454662-87454684 CATGAACCCCAAGCTGGAGAGGG - Intronic
1045408445 8:101891589-101891611 GATGAACCCGATACCTCAGATGG - Intronic
1047579581 8:126199506-126199528 GATGAACCCGGTACCGCAGATGG - Intergenic
1048185721 8:132238785-132238807 GATGGACCCCTAACCCAAGCTGG - Intronic
1062078015 9:134602630-134602652 GATGAGCCCCAAACCTCAGTTGG + Intergenic
1062296203 9:135828514-135828536 GCTAAACCCCCAACCCAAGAAGG + Intronic
1186231195 X:7456043-7456065 GTCGTACCCCAAACCAAAGAAGG + Intergenic
1186967970 X:14809279-14809301 GATGAACCCCGTACCTCAGATGG - Intergenic
1188936065 X:36176216-36176238 GATGAACCCCGTACCTCAGATGG + Intergenic
1191687305 X:63904725-63904747 GATGAACCCAGTACCTAAGATGG + Intergenic
1192037831 X:67584826-67584848 GTTTAACCCCAAACCAAAGAAGG - Intronic
1194441489 X:93939831-93939853 GATGAACCCCGTACCTCAGATGG - Intergenic
1195355199 X:104032792-104032814 GATGAACCCCGTACCTCAGATGG + Intergenic
1199549488 X:149043068-149043090 CATGAACCCCAAACACCAGAGGG - Intergenic
1201519819 Y:14861198-14861220 GATGAACCCAATACCTCAGATGG - Intergenic