ID: 1157587160

View in Genome Browser
Species Human (GRCh38)
Location 18:48810199-48810221
Sequence GTGGCTATCCCGACTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157587160_1157587166 16 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587166 18:48810238-48810260 ATATTGTCACATGTGGATAGTGG 0: 1
1: 0
2: 3
3: 51
4: 374
1157587160_1157587167 28 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587167 18:48810250-48810272 GTGGATAGTGGCTACCATATTGG 0: 3
1: 118
2: 393
3: 905
4: 1455
1157587160_1157587165 9 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587165 18:48810231-48810253 GCTCAATATATTGTCACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157587160 Original CRISPR GTGGCTATCCCGACTGATAT GGG (reversed) Intronic
919263367 1:195228241-195228263 CTTGCTATCCAGGCTGATATGGG + Intergenic
921991634 1:221373043-221373065 GTGGCTCTGCTCACTGATATGGG - Intergenic
1066072672 10:31835912-31835934 GTGGCTATCACCTCTGTTATAGG - Intronic
1086905647 11:92415168-92415190 ATGGCTATCCACACTGAAATTGG - Intronic
1087690944 11:101320220-101320242 GTGGCCATCACCACTGAGATTGG + Intergenic
1095239418 12:39839190-39839212 GTCGCTGTCCCGACTGGTAGTGG - Intronic
1101555049 12:105801092-105801114 GTGGCTATCTTGACCCATATAGG - Intergenic
1103884462 12:124190229-124190251 GTGACTATCCTGAATGATCTGGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1138707608 16:58933605-58933627 GTGGCTTTCCCGATTAATACAGG + Intergenic
1148037852 17:44681838-44681860 GTGGATATGCGGAGTGATATTGG - Intronic
1149599053 17:57881615-57881637 TGGGCTATTCCCACTGATATGGG + Intronic
1151566174 17:74899753-74899775 GTGTTTATCCTGACTGATACAGG - Intergenic
1157560563 18:48642680-48642702 TAGGCTATCCTGACTGATACAGG - Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1171753335 20:29077099-29077121 GTAGCTATTCTGACTGGTATAGG + Intergenic
1171788921 20:29500463-29500485 GTAGCTATTCTGACTGGTATAGG - Intergenic
1172759058 20:37309247-37309269 CTGTCAATCCCGACTGATAAGGG - Intronic
1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG + Intergenic
1181966973 22:26663555-26663577 GTGGCTTTCCCGACTGACCTTGG + Intergenic
952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG + Intergenic
977021945 4:91770616-91770638 GTGGCTCTCCTGATTGATGTGGG - Intergenic
985302009 4:188500092-188500114 GTGGCATTCCCGTCTGACATGGG - Intergenic
1018494056 6:164329903-164329925 GTGGCTGTCCTGACTAATAGAGG + Intergenic
1018698548 6:166409318-166409340 GGAGCTATCCAGACTGTTATTGG + Intergenic
1058111195 9:101032104-101032126 GTGGCTGTAGCGACAGATATGGG + Intronic
1203449937 Un_GL000219v1:102765-102787 GTAGCTATTCTGACTGGTATAGG - Intergenic