ID: 1157587165

View in Genome Browser
Species Human (GRCh38)
Location 18:48810231-48810253
Sequence GCTCAATATATTGTCACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157587160_1157587165 9 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587165 18:48810231-48810253 GCTCAATATATTGTCACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 141
1157587161_1157587165 8 Left 1157587161 18:48810200-48810222 CCATATCAGTCGGGATAGCCACA 0: 1
1: 1
2: 0
3: 4
4: 48
Right 1157587165 18:48810231-48810253 GCTCAATATATTGTCACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 141
1157587164_1157587165 -10 Left 1157587164 18:48810218-48810240 CCACACTTCAAGGGCTCAATATA 0: 1
1: 0
2: 4
3: 65
4: 431
Right 1157587165 18:48810231-48810253 GCTCAATATATTGTCACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157587165 Original CRISPR GCTCAATATATTGTCACATG TGG Intronic
903176372 1:21583926-21583948 GCTCAATAACTTGACACCTGAGG + Intergenic
909229846 1:73072651-73072673 GTTCAATAAATTGTCTCGTGTGG - Intergenic
910053507 1:83004464-83004486 CCACACTATACTGTCACATGTGG - Intergenic
913324571 1:117615552-117615574 GCTAAACATCTAGTCACATGTGG + Intronic
915873988 1:159592763-159592785 GATCAATGTATAGTCACATTTGG + Intergenic
916339869 1:163720697-163720719 GCTCAATATAAAATCACAAGAGG - Intergenic
916585153 1:166143795-166143817 GCTCAATGTATTGTCAGTTATGG - Intronic
917887981 1:179406269-179406291 GCCTAATATATGGTCACTTGTGG + Intronic
918763165 1:188441360-188441382 TCTCAATATAATGTAACTTGTGG + Intergenic
919791684 1:201295032-201295054 CCTCAAGACATTGTCAGATGGGG + Intronic
919894582 1:202001482-202001504 TCTCAAGGTATAGTCACATGAGG + Exonic
924479915 1:244420428-244420450 GCTCACTCTATTGTAACATTTGG + Intronic
1064385794 10:14890098-14890120 TATCACTATATTGTCAGATGTGG - Intronic
1068528521 10:58158654-58158676 CCTCCAAATATTCTCACATGGGG - Intergenic
1068654661 10:59562444-59562466 GTTAAATATCTTGTCCCATGAGG - Intergenic
1068825774 10:61437251-61437273 TCTCCAAATATTGTCACATTTGG + Intronic
1071725849 10:88197660-88197682 TCTCAAAATATAGTCACATTGGG - Intergenic
1075159476 10:120010713-120010735 GCTCAATATAAAGTTAGATGAGG - Intergenic
1076983002 11:215023-215045 TCTCAATCTATGGTCACACGAGG - Exonic
1077597193 11:3544117-3544139 TCTCTGGATATTGTCACATGAGG + Intergenic
1078361279 11:10669762-10669784 GCTCAGTATTTTATCCCATGGGG - Intronic
1080073798 11:28123400-28123422 GCTCAGTAGTTTGTTACATGAGG - Intronic
1081412428 11:42775715-42775737 GCTCTTTAAATTGTCTCATGAGG - Intergenic
1084253292 11:67920016-67920038 TCTCTGGATATTGTCACATGAGG + Intergenic
1084819588 11:71675916-71675938 TCTCTGGATATTGTCACATGAGG - Intergenic
1085830340 11:79893784-79893806 ACTCACTATATTATTACATGAGG + Intergenic
1087170186 11:95041930-95041952 ACTGAATATATTGCCAAATGTGG + Intergenic
1087426618 11:97995793-97995815 TCTCACTGTATTTTCACATGGGG + Intergenic
1087470828 11:98572186-98572208 GCTCAAAATAGTGTCATAAGAGG + Intergenic
1087890468 11:103532088-103532110 TCTGAATATAGTGTAACATGGGG - Intergenic
1089196722 11:116697812-116697834 ACTCAATTTATTCTCACATCTGG - Intergenic
1089333894 11:117709484-117709506 GCCCCAAATATAGTCACATGGGG + Intronic
1090869867 11:130734614-130734636 TCTCCATATATAGTCACATTGGG + Intergenic
1091072357 11:132579672-132579694 GCTCAGTACAGTGGCACATGGGG + Intronic
1091862545 12:3799132-3799154 CCTCCAAATACTGTCACATGGGG - Intronic
1092423531 12:8354834-8354856 TCTCTGGATATTGTCACATGAGG + Intergenic
1093779104 12:23113345-23113367 GGTCAAAATTTTGTCACATGGGG - Intergenic
1097472377 12:60010588-60010610 TCTCCAAATACTGTCACATGGGG - Intergenic
1099886293 12:88535407-88535429 GCTTAATATAATCTCTCATGGGG - Intronic
1104267778 12:127252601-127252623 CCTCAAAATATTGTCACATTGGG - Intergenic
1105329371 13:19400794-19400816 GATAAATATATTGTCATGTGAGG + Intergenic
1105704706 13:22961778-22961800 CCTCACTGTATCGTCACATGGGG - Intergenic
1105862484 13:24428474-24428496 GATAAATATATTGTCAAGTGAGG - Intronic
1111654116 13:91130923-91130945 GCTTAATTTCTTGTCAAATGGGG + Intergenic
1114185172 14:20395801-20395823 GCTTCATTTATTGTCAGATGTGG + Intronic
1120871063 14:89337966-89337988 GCACCAAATATTGTCACAGGAGG - Intronic
1121868057 14:97381039-97381061 TCTCATTATAGTCTCACATGTGG + Intergenic
1125365373 15:38909109-38909131 GCTCAATATATTGTCTGTTCTGG + Intergenic
1127954082 15:63837272-63837294 GATCGATATAATATCACATGAGG + Intergenic
1129490133 15:75916547-75916569 TCTCCAAATATAGTCACATGGGG + Intronic
1133374758 16:5275098-5275120 TCTCTGGATATTGTCACATGAGG - Intergenic
1135160497 16:20090929-20090951 TCTCCAGATATTGTCACCTGGGG - Intergenic
1144244722 17:13351514-13351536 GCTCAAGATATTGTCTCAAATGG - Intergenic
1146783255 17:35695236-35695258 GATCAATATAGTATCACAGGTGG + Intronic
1148656663 17:49289150-49289172 CCTCAAAATGTTGTCACCTGAGG + Intergenic
1148977061 17:51538905-51538927 TCTCATTGTATTTTCACATGGGG + Intergenic
1149631515 17:58129027-58129049 CCTCAATATATTGGCACTTTGGG - Intergenic
1156942485 18:42786085-42786107 GCTCAAATTTTTGGCACATGAGG + Intronic
1157464608 18:47931998-47932020 GCTCAATATTTTGTCAGCAGAGG - Intergenic
1157587165 18:48810231-48810253 GCTCAATATATTGTCACATGTGG + Intronic
1158414004 18:57233203-57233225 GCTCAAAATATTCTAACATGGGG - Intergenic
1161915030 19:7221948-7221970 GCTCAATATATCGTGGCTTGTGG - Intronic
1162992123 19:14310292-14310314 GGGCAACATATTGTCCCATGGGG - Intergenic
925809290 2:7683158-7683180 GCCCATTATGTTTTCACATGAGG - Intergenic
926325453 2:11781673-11781695 GCTCAATACATTTTCACAGCAGG + Intronic
929507151 2:42537014-42537036 CTTCAATATATTGTAGCATGTGG + Intronic
930307887 2:49699252-49699274 GCTCAATATATTATCACATATGG + Intergenic
930702564 2:54473634-54473656 CCAAAATATATTTTCACATGAGG - Intronic
933435774 2:82247868-82247890 CCTCAGTTTCTTGTCACATGTGG + Intergenic
935241663 2:101183620-101183642 ACTCCAGATATTGTCACATTAGG + Intronic
940566696 2:155372153-155372175 GCTCAATCAATTGTGTCATGAGG - Intergenic
943371434 2:187021497-187021519 GCTCGATATTTTGTCACATAGGG - Intergenic
947233400 2:227913385-227913407 ACACAGTATAATGTCACATGTGG - Intronic
1169316612 20:4596692-4596714 GCTCAATATATGGTCAATTTTGG + Intergenic
1169325839 20:4675553-4675575 GCAGAATATATTGTGATATGGGG + Intergenic
1173073761 20:39796117-39796139 ACTCAAAATCTTGTCACATTTGG + Intergenic
1176992504 21:15514912-15514934 TGTCAAGATATTGGCACATGGGG - Intergenic
1177654110 21:23994894-23994916 TCTCAAAATATAGTCACATCTGG + Intergenic
1180589116 22:16921222-16921244 GCTCCATCAGTTGTCACATGTGG - Intergenic
1185144110 22:49120312-49120334 GTTCAATATCTTCTCATATGTGG + Intergenic
953319352 3:41958409-41958431 GGTGAATATATTGGCAGATGCGG + Intronic
955587517 3:60497070-60497092 TCTCCACATATTGCCACATGTGG - Intronic
957367102 3:79239953-79239975 TATCAATATATTGTAGCATGTGG + Intronic
960017372 3:112907347-112907369 GCTCAAAATCTTGTCCCAAGAGG + Intergenic
961285783 3:125801490-125801512 TCTCTGGATATTGTCACATGAGG - Intergenic
961900956 3:130211421-130211443 TCTCTGGATATTGTCACATGAGG + Intergenic
963558165 3:146823699-146823721 GCTCCATGTAATGTCACCTGGGG + Intergenic
963886371 3:150587319-150587341 ACTCAATTTATTTTCACATTTGG + Intronic
965044718 3:163561902-163561924 GCTCAAAATGATGTCACATTAGG - Intergenic
965168914 3:165234947-165234969 GCTCAATCTACAGACACATGAGG - Intergenic
965308724 3:167101324-167101346 ACTCAATCTATTGTCACAATCGG + Intergenic
965479848 3:169204830-169204852 GCTTAATATATTGTCTGTTGAGG - Intronic
966065259 3:175813809-175813831 GTACATTATATTGTCACATGCGG + Intergenic
969801514 4:9569553-9569575 TCTCTGGATATTGTCACATGAGG - Intergenic
970351003 4:15201724-15201746 GCTCCTGATCTTGTCACATGGGG + Intergenic
970542220 4:17091669-17091691 GCTAAAAATATTGTAAAATGTGG + Intergenic
970793132 4:19882610-19882632 TCTCCATATATAGTCACATTGGG + Intergenic
970894959 4:21091732-21091754 TCTCATTATATCCTCACATGAGG + Intronic
971867609 4:32192370-32192392 TTTCCATATATTGTCACATGAGG - Intergenic
972877605 4:43383019-43383041 GCTGAATATATTGAAAAATGTGG + Intergenic
974798244 4:66781050-66781072 ACTCAAAATATAGCCACATGTGG + Intergenic
975061575 4:70009292-70009314 GCTTAATATGTTGTTAGATGGGG - Intergenic
977160197 4:93625024-93625046 AATTAATCTATTGTCACATGTGG - Intronic
977406612 4:96607868-96607890 GCACAATATATTGTGATAGGAGG - Intergenic
978040121 4:104049946-104049968 GCTCATTACATTTTCACAAGTGG + Intergenic
990175635 5:53104911-53104933 GCTTAATTTATTGTCAGCTGAGG - Intronic
991167448 5:63580772-63580794 AGTCAATATATAGTCACAAGTGG + Intergenic
992995659 5:82329862-82329884 GCTCTATATTTTGCCACATAAGG + Intronic
995576542 5:113541917-113541939 GCTGTATATTTTGTCACCTGAGG + Intronic
995921648 5:117321748-117321770 TCTCTAAATATTGTCACATTGGG - Intergenic
997905648 5:137814341-137814363 TCTCAATATATTCTCACTTATGG - Intergenic
1003864805 6:10353240-10353262 GCTCATTATATGTTCATATGAGG - Intergenic
1007021339 6:38525037-38525059 TTTTAATATTTTGTCACATGGGG + Intronic
1007211949 6:40199723-40199745 GCTCACTATATTGTGACAAATGG + Intergenic
1008832724 6:55787390-55787412 GTTTAATATATAATCACATGTGG + Intronic
1009718392 6:67429456-67429478 GCTCAATATATTCTGTAATGTGG - Intergenic
1010573006 6:77500758-77500780 CCTCAACATATTGTCTCCTGGGG - Intergenic
1014398669 6:120959567-120959589 GTCTAATATATTTTCACATGTGG - Intergenic
1014722376 6:124933352-124933374 GGGCAATATATTGTCATATAGGG - Intergenic
1014746974 6:125212051-125212073 GCTCAATAATTTTTCACTTGGGG + Intronic
1016915529 6:149240903-149240925 TCTCCAAATATTGTCACATTTGG - Intronic
1018445462 6:163854055-163854077 TCTCTAAATATAGTCACATGGGG + Intergenic
1018769426 6:166957829-166957851 GCTCAATAAAATGCCACCTGTGG + Intergenic
1019326467 7:440845-440867 TCTCCAAATATAGTCACATGGGG + Intergenic
1021650860 7:22831645-22831667 GCTCCAAATACTGTCACATTGGG - Intergenic
1022059690 7:26780792-26780814 GCAAAATTTATTTTCACATGAGG + Intronic
1022881631 7:34594079-34594101 TATCAAAGTATTGTCACATGGGG + Intergenic
1024881692 7:54093247-54093269 GTTGAATATATTGCAACATGTGG + Intergenic
1031611113 7:123828566-123828588 ACTCAATATATTTTAACATTAGG - Intergenic
1032612908 7:133435088-133435110 GCTCAGTATATTGTGACAAAAGG - Intronic
1032654408 7:133912018-133912040 GAACAATATTTTGTGACATGTGG - Intronic
1033440596 7:141374654-141374676 GCTTAAGTAATTGTCACATGGGG - Intronic
1033972077 7:147054941-147054963 GCTCAAAATACTGTCATATTAGG + Intronic
1036253468 8:7185140-7185162 TCTCTGGATATTGTCACATGAGG + Intergenic
1036364025 8:8102338-8102360 TCTCTGGATATTGTCACATGAGG - Intergenic
1036939299 8:13036259-13036281 CCTCATTATATTTTCACATTTGG - Intergenic
1037622718 8:20579021-20579043 GCTCAATATCTAATCACGTGTGG - Intergenic
1039422784 8:37458342-37458364 TCTCAATATATTTTGAGATGGGG + Intergenic
1040647366 8:49414972-49414994 GCTCAATTTATTTCCACATCAGG + Intergenic
1047265929 8:123309306-123309328 ACTGCATATATTGTCAGATGTGG - Intergenic
1052391805 9:27887868-27887890 GCTCAGTATTTTGTAACAGGAGG + Intergenic
1052424332 9:28285139-28285161 GGTCAAAATATTGTGACATTTGG + Intronic
1054941840 9:70751851-70751873 GCTCAAGATATAGTCACACTGGG + Intronic
1060679087 9:125545435-125545457 GCCCAACATATTGTCACAGATGG - Intronic
1187189237 X:17017269-17017291 GCTCAATATATTCTTAAAAGTGG + Intronic
1187935674 X:24333692-24333714 GCTCAAGATAGTGTCAAAGGGGG - Intergenic
1189240392 X:39520133-39520155 GCTCAAAACATTGCCTCATGGGG + Intergenic
1199466975 X:148149072-148149094 GCTAAATGTATCTTCACATGTGG - Intergenic
1202602524 Y:26608802-26608824 GATAAATATATTGTCATGTGAGG - Intergenic