ID: 1157587166

View in Genome Browser
Species Human (GRCh38)
Location 18:48810238-48810260
Sequence ATATTGTCACATGTGGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157587164_1157587166 -3 Left 1157587164 18:48810218-48810240 CCACACTTCAAGGGCTCAATATA 0: 1
1: 0
2: 4
3: 65
4: 431
Right 1157587166 18:48810238-48810260 ATATTGTCACATGTGGATAGTGG 0: 1
1: 0
2: 3
3: 51
4: 374
1157587161_1157587166 15 Left 1157587161 18:48810200-48810222 CCATATCAGTCGGGATAGCCACA 0: 1
1: 1
2: 0
3: 4
4: 48
Right 1157587166 18:48810238-48810260 ATATTGTCACATGTGGATAGTGG 0: 1
1: 0
2: 3
3: 51
4: 374
1157587160_1157587166 16 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587166 18:48810238-48810260 ATATTGTCACATGTGGATAGTGG 0: 1
1: 0
2: 3
3: 51
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157587166 Original CRISPR ATATTGTCACATGTGGATAG TGG Intronic
900912255 1:5607436-5607458 AAATAGTCACATGTAGTTAGTGG - Intergenic
901255191 1:7818662-7818684 AAATTGCCACATGTGGCAAGTGG - Intronic
901427020 1:9188472-9188494 AAATAGTCACATGTAGTTAGTGG - Intergenic
902168511 1:14592178-14592200 AAATTGTCACATGTGAATCCTGG - Intergenic
902310981 1:15581504-15581526 TGTGTGTCACATGTGGATAGTGG - Intronic
903240517 1:21979776-21979798 CAATAGTCACATGTGGCTAGTGG + Intronic
903244259 1:22004395-22004417 CAATAGTCACATGTGGCTAGTGG + Intronic
904075837 1:27841601-27841623 ATGTAGTCACATATGGCTAGTGG + Intronic
905024705 1:34841762-34841784 AAATAGTCACATGTGGCTAATGG + Intronic
905841963 1:41188442-41188464 AAATAGCCACATGTGGCTAGTGG - Intronic
906246508 1:44278987-44279009 CTACTGCCACATGTGGCTAGTGG + Intronic
906401947 1:45510910-45510932 ATATTGACACAGGTAGATATAGG - Exonic
908430093 1:64048218-64048240 AAATAGCCACATGTGGCTAGTGG - Intronic
909149359 1:71981486-71981508 ATATTTTGAGATGTGCATAGTGG + Intronic
909357076 1:74721971-74721993 AAATTGCCACATGTAGCTAGTGG + Intronic
909511901 1:76462851-76462873 ATTTTTTAAAATGTGGATAGTGG - Intronic
909539374 1:76773586-76773608 AAATAGCCACATGTGGCTAGTGG - Intergenic
909842117 1:80340576-80340598 ATATAGCCACATGTAGTTAGTGG + Intergenic
910053504 1:83004457-83004479 ATACTGTCACATGTGGGAATGGG - Intergenic
910964117 1:92790369-92790391 ATAATAGCACATGTGGCTAGTGG + Intronic
911204453 1:95078405-95078427 AAATAGACACATGTGGCTAGTGG + Intergenic
911380068 1:97103392-97103414 ATATTATCAAATTTGGACAGTGG + Intronic
911627279 1:100138737-100138759 AAATAGTCATATGTGGCTAGTGG - Intronic
912113865 1:106379487-106379509 AAGTTGTAACATGTGGATAATGG - Intergenic
912461707 1:109837645-109837667 AGATTGTGACATTTGAATAGAGG + Intergenic
913091216 1:115477958-115477980 AAATAGTCACATGTGGCTAGTGG - Intergenic
917452269 1:175157028-175157050 AAATAGTCACATGTGGCTATTGG + Intronic
918217959 1:182409447-182409469 AAATAGCCACATGTGGTTAGTGG - Intergenic
918627795 1:186678470-186678492 TTATTGTAAAATGTGGAAAGTGG + Intronic
919413672 1:197278976-197278998 CTATTTTCACATGTAGATAGAGG + Intronic
919437762 1:197584433-197584455 CAATGGTCACATGTGGTTAGTGG + Intronic
919754054 1:201055528-201055550 AAATAGTCACATGTGGCTAATGG - Intronic
919930224 1:202216562-202216584 ATATAGTCACAAGCGGCTAGTGG + Intronic
920277954 1:204822223-204822245 AAATAGTCACATGCGGCTAGTGG + Intergenic
921245775 1:213238281-213238303 AGATTTTCACAAGTGGATACTGG + Intronic
922026352 1:221752918-221752940 AAATAGCCACATGTGGCTAGTGG - Intergenic
922092004 1:222404767-222404789 TTATTGTCACAAGTAGATAAGGG + Intergenic
923901371 1:238329288-238329310 ATTTTGTTACATGTGGACAGCGG + Intergenic
1062784672 10:253265-253287 ATAATTTCACATATGGATAAAGG - Exonic
1063905054 10:10773008-10773030 ATATTGTCACATTTGAATGGGGG + Intergenic
1064885884 10:20111898-20111920 ATATGGTCACATTGGGAAAGGGG - Intronic
1065888156 10:30097237-30097259 AAATAGCCACATGTGGCTAGTGG + Intronic
1066463816 10:35635701-35635723 ATAGTATCAAATGTGGAAAGCGG + Intergenic
1067027335 10:42855894-42855916 GTATTGTCACACGTGGATGCTGG - Intergenic
1067516185 10:46947049-46947071 AAATTATCACATGTTTATAGTGG + Intronic
1067646062 10:48104758-48104780 AAATTATCACATGTTTATAGTGG - Intergenic
1068829773 10:61480145-61480167 AAATGGCCACATGTGGCTAGTGG + Intergenic
1069152779 10:64986192-64986214 ATGTTTTCTCATGTAGATAGAGG + Intergenic
1070264021 10:74885333-74885355 ATATAGTCGCATGTGATTAGTGG + Intronic
1070725242 10:78783230-78783252 GCATTCTCACATGTGGAAAGGGG - Intergenic
1071775893 10:88787490-88787512 ATATAGCCACATGTGGCTAGTGG - Intergenic
1073482454 10:103795246-103795268 AAATAGCCACATGTGGCTAGTGG + Intronic
1074736313 10:116437747-116437769 TAATAGTCACATGTGGCTAGTGG - Intronic
1075928185 10:126270542-126270564 AAATAGCCACATGTGGCTAGTGG + Intronic
1078518599 11:12045972-12045994 AAATAGCCACATGTGGCTAGTGG + Intergenic
1079634692 11:22721599-22721621 AAATAGCCACATGTGGATAGTGG - Intronic
1083194541 11:61077036-61077058 AAATAGCCACATGTGGCTAGTGG - Intergenic
1086547030 11:88009534-88009556 AGATTGTAACATGATGATAGAGG + Intergenic
1086583685 11:88427808-88427830 ACATTGTCAGATGTGCATAAGGG + Intergenic
1087972860 11:104507178-104507200 AAATAGTCACATGTGGCTAATGG - Intergenic
1087972932 11:104507789-104507811 TAATGGTCACATGTGGCTAGTGG + Intergenic
1088128783 11:106461923-106461945 AAATAGCCACATGTGGCTAGTGG + Intergenic
1088150695 11:106741330-106741352 CAATAGTCACATGTGGCTAGTGG + Intronic
1088212216 11:107469319-107469341 AAATAGGCACATGTGGTTAGTGG - Intergenic
1088388933 11:109291838-109291860 ATATTTTCACATGTCCAGAGTGG + Intergenic
1088600485 11:111470075-111470097 ATATTGTCATATGTGGCTTGAGG - Intronic
1088722292 11:112604736-112604758 AATTTGTCACTTGTGAATAGAGG - Intergenic
1088839581 11:113612988-113613010 CAATAGTCACATGTGGCTAGGGG - Intergenic
1089069822 11:115690678-115690700 AAATAGTCACATGTCGCTAGTGG - Intergenic
1089364168 11:117910892-117910914 ACAATGTCACATGGGGAAAGGGG - Intronic
1089800059 11:121020527-121020549 AAATAGCCACATGTGGCTAGTGG + Intergenic
1091623862 12:2107939-2107961 AGATAGTCACATGTGGCTAGAGG - Intronic
1092227920 12:6760649-6760671 AAATAGCCACATGTGGCTAGTGG - Intronic
1092653414 12:10659039-10659061 AGATTGTGACATTAGGATAGAGG + Intronic
1093106592 12:15094939-15094961 CAATTGCCACATGTGGCTAGTGG - Intergenic
1093183379 12:15992278-15992300 ATTTTGGCACATCTGGAAAGAGG - Intronic
1093197178 12:16143275-16143297 ATACAGTCATATGTAGATAGAGG + Intergenic
1093347154 12:18051910-18051932 ATTTTGTCACTTGTGAATACAGG + Intergenic
1094322595 12:29201736-29201758 ATATAGTGACATGTGGCTAATGG - Intronic
1094632154 12:32186375-32186397 AAGTGGTCACATGTGGGTAGTGG + Intronic
1095460256 12:42436005-42436027 ATATAGTCACATATGGCTAGTGG + Intronic
1095904143 12:47360194-47360216 ATATAGCCATATGTGGCTAGTGG - Intergenic
1096345124 12:50839573-50839595 AAATTGTCACATGTGGTGAGGGG + Intergenic
1096823556 12:54256573-54256595 AAATAGGCACATGTGGCTAGTGG - Intronic
1097688697 12:62714249-62714271 AAATGGCCACATGTGGCTAGTGG + Intronic
1098174353 12:67775411-67775433 AGAATGTCACAGGTGGAGAGGGG + Intergenic
1098259249 12:68651231-68651253 TTATTGTCACATGCTGTTAGTGG - Intronic
1098607728 12:72413338-72413360 CAATAGTCACATGTGGCTAGTGG - Intronic
1099368357 12:81798089-81798111 AAATAGTCACATGTGGCTAGTGG + Intergenic
1099439250 12:82681696-82681718 ATTTAGTGACATGTGGCTAGTGG - Intergenic
1099447753 12:82772408-82772430 TAATTGTCACATGTGGCTACTGG - Intronic
1101536140 12:105618352-105618374 ACATTCACACATGTGAATAGTGG + Intergenic
1101974862 12:109348381-109348403 AAATAGCCACATGTGGCTAGTGG + Intronic
1102489432 12:113280609-113280631 AAATTGCCACATGTGGCCAGTGG - Intronic
1102730780 12:115107050-115107072 ATTTTGTGACATGTGTATACGGG - Intergenic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1103406042 12:120676150-120676172 AAATAGTCACATATGGCTAGTGG - Intergenic
1105786277 13:23752744-23752766 GTATTGCCACATGTGTTTAGTGG + Intronic
1106092502 13:26609928-26609950 AAATAGTAACATGTGGCTAGTGG - Intronic
1106352990 13:28952614-28952636 ATATGGTTACCTGGGGATAGAGG - Intronic
1107309757 13:39063758-39063780 AAATTGTCTCATGTGGCTATTGG + Intergenic
1108297243 13:49036277-49036299 AAATAGTCACATGTGGTTAATGG - Intronic
1108807268 13:54174178-54174200 ATATTCACACATTTGGATATTGG - Intergenic
1109604070 13:64668927-64668949 ATATAGCCACTTGTGGCTAGTGG + Intergenic
1111971402 13:94920846-94920868 AAATAGCCACATGTGGCTAGTGG + Intergenic
1112799145 13:103091682-103091704 AAATAGTTACATGTGGCTAGTGG - Intergenic
1114185001 14:20394406-20394428 AAATAGCCACATGTGGCTAGTGG + Intronic
1114194698 14:20467003-20467025 CGATAGTCACATGTGGTTAGTGG - Intergenic
1114739131 14:25076718-25076740 AAATTGTCACATATGGCTGGTGG - Intergenic
1115195816 14:30798291-30798313 AAATGGCCACATGTGGCTAGTGG + Intergenic
1115997971 14:39213054-39213076 CAATAGTCACATGTGGCTAGTGG - Intergenic
1118100492 14:62595561-62595583 AGATAGTCACATGAGGCTAGTGG + Intergenic
1118357119 14:65023692-65023714 AAATTGCCTCATGTGGCTAGTGG + Intronic
1119909682 14:78338225-78338247 ATGTAGTCACATGTGGCTAATGG - Intronic
1120191120 14:81440660-81440682 AAATAGCCACATGTGGTTAGAGG + Intergenic
1120627820 14:86850796-86850818 AAATAGCCACATGTGGCTAGTGG - Intergenic
1120981554 14:90293575-90293597 AAATAGCCACATGTGGCTAGAGG + Intronic
1121790046 14:96692556-96692578 ATTTTGTCATATGTGCATAGTGG + Intergenic
1122331289 14:100916376-100916398 AAATAGTCACATGTGGCTACTGG + Intergenic
1122333379 14:100945169-100945191 AAATAGCCACATGTGGATAGAGG - Intergenic
1123426996 15:20180750-20180772 GTATTGTCACACGTGGATGCTGG - Intergenic
1123536225 15:21187259-21187281 GTATTGTCACACGTGGATGCTGG - Intergenic
1123986402 15:25650213-25650235 GTATTCTCACATGGGGAAAGGGG + Intergenic
1124122842 15:26906103-26906125 ATATTCTCCCATGTCCATAGTGG + Intronic
1125259643 15:37808603-37808625 AAATGGCCACATGTGGCTAGTGG + Intergenic
1125307820 15:38341475-38341497 ATATTGTAAAATGTGGATAGAGG - Intronic
1126990349 15:54367913-54367935 AAATAGTCACATTTGGCTAGTGG + Intronic
1127159836 15:56170629-56170651 AAATAGCCACATGTGGCTAGTGG - Intronic
1127612547 15:60651053-60651075 ATATTGTCAGCGGTGGAAAGAGG + Intronic
1127829224 15:62735863-62735885 ATATTGGCATATTTGTATAGTGG + Intronic
1128077163 15:64834668-64834690 AAATAGCCACATGTGGCTAGTGG - Intergenic
1128077167 15:64834741-64834763 CAATTGCCACATGTGGTTAGTGG + Intergenic
1129610180 15:77047338-77047360 ATGTAGACACATGTGGCTAGTGG + Intronic
1129900751 15:79147066-79147088 CAATAGTCACATGTGGCTAGTGG + Intergenic
1130439762 15:83941931-83941953 ATATTCTCCAATGTGGTTAGGGG + Intronic
1131347055 15:91659813-91659835 AAATAGCCACACGTGGATAGTGG - Intergenic
1133091464 16:3407571-3407593 ACATAGTCACATGTGGCTAGTGG + Intronic
1134156237 16:11845542-11845564 AAATAGGCACATGTGGCTAGTGG - Intronic
1135115540 16:19719995-19720017 AAATAGCCACATTTGGATAGTGG + Intronic
1135207349 16:20494434-20494456 ACATTTTCAGATGTGGATACTGG + Intergenic
1135211536 16:20529198-20529220 ACATTTTCAGATGTGGATACTGG - Intergenic
1135251429 16:20903442-20903464 AAATAGTCACATGTGGTCAGTGG - Intronic
1136857302 16:33669086-33669108 GTATTGTCACACGTGGATGCTGG + Intergenic
1137055128 16:35742024-35742046 ATACTTTCACCTGTGGATACTGG - Intergenic
1139148648 16:64352725-64352747 ATATTCTCACATGGTGAAAGAGG - Intergenic
1140156728 16:72436622-72436644 AAATAGTCACATGTGGCTAGGGG + Intergenic
1140203218 16:72911632-72911654 AAATAGTCACATGTGGCTAGTGG - Intronic
1141029594 16:80575934-80575956 TTAAAGTCACATGTGGCTAGTGG + Intergenic
1142278241 16:89134049-89134071 ATATTTCGACATTTGGATAGTGG + Intronic
1203118875 16_KI270728v1_random:1517577-1517599 GTATTGTCACACGTGGATGCTGG + Intergenic
1143887069 17:10072682-10072704 ATATTGACTCCTGTGGATCGGGG - Intronic
1144102293 17:11952498-11952520 AAATAGCCACATGTGGCTAGTGG + Intronic
1144217692 17:13070920-13070942 CTGTTGGCACATGTGTATAGTGG - Intergenic
1144272046 17:13626977-13626999 AAATAGTTACATGTGGATAATGG - Intergenic
1144428434 17:15168106-15168128 AAAATGTCACATGTGAATGGTGG - Intergenic
1144655148 17:17030362-17030384 ATATAGCCACATGGGGCTAGTGG + Intergenic
1146328681 17:31909433-31909455 AAATTGTCACATGTAGCTAGTGG + Intergenic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1147015360 17:37487848-37487870 AGATAGCCACATGTGGCTAGTGG - Intergenic
1147863884 17:43540676-43540698 AAATAGGCACATTTGGATAGAGG + Intronic
1148405703 17:47412793-47412815 ATCTTGTCACATGTCGATAATGG + Exonic
1149479709 17:56993176-56993198 ATATAGTCACATGTGGCAAGTGG - Intronic
1149646837 17:58247324-58247346 AAATAGCCACATGTGGTTAGTGG + Intronic
1149676370 17:58466649-58466671 AAATAGCCACATGTGGCTAGTGG + Intronic
1149745113 17:59089308-59089330 AAAGAGTCACATGTGGCTAGTGG - Intronic
1150202485 17:63371762-63371784 ATAATGTTAAATGAGGATAGAGG + Intronic
1150453826 17:65291209-65291231 AAAAAGTCACATGTGGCTAGTGG - Intergenic
1150756181 17:67916202-67916224 ATGGTGTCACAAGTGGATATGGG + Intronic
1151912280 17:77091603-77091625 AAATAGTCACATGTGGCTAGTGG + Intronic
1154955338 18:21248730-21248752 AAATAGCCACATGTGGCTAGAGG - Intronic
1154993495 18:21618094-21618116 ATATTGTAGCATGTGGAGAGGGG - Intronic
1156275998 18:35582884-35582906 TAATAGTCACATGTGGTTAGTGG - Intronic
1156418388 18:36923710-36923732 AAATTGTCACATATAGCTAGTGG - Intronic
1156652576 18:39241979-39242001 ATATGGTCACATTTGGCAAGTGG + Intergenic
1157210455 18:45737701-45737723 ATATAGCCACATGGGGCTAGAGG - Intronic
1157250417 18:46090710-46090732 AAATAGCCACATGTGGTTAGTGG - Intronic
1157587166 18:48810238-48810260 ATATTGTCACATGTGGATAGTGG + Intronic
1157852286 18:51066679-51066701 AAATAGTCACATGTGGCTAGTGG + Intronic
1158841560 18:61393611-61393633 AGATTGGCACCTGTGGATAGTGG + Intronic
1159016906 18:63108372-63108394 AAATAGCCACATGTGGCTAGTGG - Intergenic
1159593467 18:70359952-70359974 ATATGGGCACATGTGACTAGTGG + Intergenic
1162963432 19:14142854-14142876 AAATAGCCACATGTGGCTAGTGG - Intergenic
1162992121 19:14310285-14310307 ATATTGTCCCATGGGGGTTGCGG - Intergenic
1165529286 19:36383913-36383935 ATATTTTCACATCTGAATATTGG - Intronic
1165610807 19:37150474-37150496 ACATTGTCACAAGTGGGAAGAGG + Exonic
1166006023 19:39907280-39907302 AAATGGTCACAAGTGGCTAGTGG - Intronic
926278869 2:11428447-11428469 AAATAGCCACATGTGGCTAGTGG + Intergenic
927022919 2:19035976-19035998 AAATAGTCACATGTGACTAGTGG - Intergenic
927414176 2:22859380-22859402 ATATTCTCAAATGGGGAGAGAGG - Intergenic
927764802 2:25796817-25796839 AAATAGCCACATGAGGATAGTGG - Intronic
930133327 2:47875279-47875301 ACATAGTCACATGTGGCAAGTGG + Intronic
930215049 2:48687233-48687255 ATTTAGCCACATGTGGCTAGTGG + Exonic
930397460 2:50841462-50841484 ACATTGTCACTTTTTGATAGTGG - Intronic
930589194 2:53307097-53307119 AAATGGTCACATGTGGCTAGTGG + Intergenic
931486743 2:62701423-62701445 CAATAGTCACATGTGGTTAGAGG + Intronic
931703823 2:64930320-64930342 ACATTGTAACATATGCATAGTGG + Intergenic
933221447 2:79694564-79694586 ATAATTTCACATTTGAATAGAGG + Intronic
933361810 2:81296406-81296428 ATATTGCCACATATGGATGTTGG - Intergenic
934059504 2:88281099-88281121 AAATAGCCACATGTGGCTAGTGG - Intergenic
934104608 2:88684149-88684171 ATATTGTGACATTAGAATAGAGG + Intergenic
936838198 2:116734061-116734083 TTATTGCCACATGAGGATATGGG - Intergenic
936878218 2:117217948-117217970 ATTTTGGCAAATGTGAATAGTGG - Intergenic
937111420 2:119369470-119369492 ATATAGTCATATGTGGCTACTGG - Intronic
937969520 2:127538430-127538452 AAATAGCCACATGTGGCTAGTGG + Intronic
938413583 2:131085952-131085974 AAGTAGTCACATGTGGCTAGTGG + Intronic
939927904 2:148196914-148196936 ATTTTGGCACATGTGGATGGAGG - Intronic
940046902 2:149419441-149419463 AAATAGTCACATGTGGCCAGTGG - Intronic
941614674 2:167705803-167705825 AAATAGCCACATGTGGTTAGTGG - Intergenic
941659152 2:168177598-168177620 ATTTTGTCACCTGGTGATAGAGG + Intronic
942241930 2:173970912-173970934 TAATGGTCACATGTGGTTAGTGG - Intergenic
943472955 2:188317807-188317829 ATATTGTGGCATATGTATAGTGG + Intronic
943814109 2:192229639-192229661 CAATTGTCACATGGGGCTAGTGG - Intergenic
948546411 2:238732648-238732670 CTATTGTAACAGGTGAATAGTGG + Intergenic
1169513908 20:6295918-6295940 AAATAGCCACATGTGGCTAGTGG - Intergenic
1169698110 20:8414798-8414820 AAATAGCCACATGTGGCTAGTGG + Intronic
1169926608 20:10790807-10790829 AAATAGACACATGTGGCTAGTGG + Intergenic
1170409499 20:16073393-16073415 AAATTGCCACATGTGGCTAGTGG + Intergenic
1170814411 20:19700526-19700548 ATATAGCCACATGTGGCTTGTGG + Intronic
1171862267 20:30412001-30412023 ATATTGTGACATTAGAATAGAGG - Intergenic
1172238022 20:33391425-33391447 AAATAGCCACATGTGGCTAGTGG + Intronic
1173793960 20:45845745-45845767 CCATAGTCACATGTGGCTAGTGG - Intronic
1174078607 20:47955426-47955448 CCATAGTCACATGTGGCTAGCGG + Intergenic
1174622511 20:51886845-51886867 AAATTGCCACATGTGGCTAGTGG - Intergenic
1174725475 20:52857134-52857156 AAATGGCCACATGTGGCTAGCGG - Intergenic
1175303362 20:57958794-57958816 TTATTTTCACAAGTGCATAGCGG - Intergenic
1175522428 20:59610536-59610558 AAATTGCCACATGTAGTTAGTGG - Intronic
1175564648 20:59963539-59963561 AAATTGCCACATGTGACTAGAGG - Intronic
1178288039 21:31342467-31342489 ATATTGTCACATGTGACTGTTGG - Intronic
1178474117 21:32921425-32921447 AAATAGTCACATGTGATTAGTGG + Intergenic
1179132524 21:38651402-38651424 CCATAGTCACATGTGGCTAGTGG - Intronic
1181618920 22:24074471-24074493 ATATTCTCATTTGTGGAGAGTGG + Intronic
1182852552 22:33488162-33488184 AAATTGCCACATGTGGCTAGTGG - Intronic
949938370 3:9135065-9135087 AAATAGCCACATGTGGCTAGTGG - Intronic
950145833 3:10649049-10649071 AAATGGCCACATGTGGCTAGTGG - Intronic
950753615 3:15153435-15153457 AATTTGTCAGGTGTGGATAGGGG - Intergenic
950829177 3:15858189-15858211 AAATTGCTACATGTGGCTAGTGG + Intronic
950888792 3:16384723-16384745 AAATAGCCACATGTGGCTAGTGG - Intronic
950938377 3:16866740-16866762 ATATTGCCACATTTGGAGACAGG - Intronic
951095303 3:18622465-18622487 AAATAGTCACATGTGGCTACTGG + Intergenic
951227251 3:20135056-20135078 ATATAAACACATGTGTATAGAGG - Intronic
951232779 3:20199183-20199205 ATATTGTCACATTTATATATTGG + Intergenic
951475041 3:23096042-23096064 ATTTTGTCACATTTGGCTTGGGG - Intergenic
951506440 3:23450394-23450416 ATTTTGCTACATGTGGCTAGTGG + Intronic
951691909 3:25405623-25405645 AAATTGCCACATGTGGTTAGTGG - Intronic
951793220 3:26509562-26509584 ATATAGTTACATGTGGACAAAGG + Intergenic
952187783 3:30989163-30989185 ATATGGTCATATGTGAATTGTGG - Intergenic
952521568 3:34163952-34163974 AAATAGCCACATGTGGCTAGTGG - Intergenic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
952927357 3:38329857-38329879 AAATGGCCACATGTGGCTAGTGG + Intergenic
953168298 3:40484741-40484763 AAATAGCCACATGTGGCTAGTGG + Intronic
953449570 3:42995035-42995057 AAATAGTCACATGTGGCTAGTGG + Intronic
953648430 3:44776781-44776803 ATATAGTCACATTTGGCTAGAGG - Intronic
953789968 3:45939810-45939832 ATATAGCCACATATGGCTAGTGG - Intronic
953967418 3:47320352-47320374 AAATAGTCACATGTGGCTAATGG + Intronic
955402233 3:58600644-58600666 AAATAGTCGCATGTGGCTAGTGG - Intronic
955710800 3:61777337-61777359 AAATAGCCACATGTGGCTAGTGG + Intronic
955731291 3:61990123-61990145 AAATAGTCACATGTGGCTAGTGG - Intronic
955864032 3:63362784-63362806 ATATTGGCATCTTTGGATAGAGG - Intronic
956899137 3:73695802-73695824 AGATAGGCACATGTGCATAGTGG + Intergenic
958428033 3:94002230-94002252 AAAAAGTCACATGTGGCTAGTGG - Intronic
959063737 3:101637354-101637376 ATACTGTCACCTATGGATATCGG + Intergenic
960314607 3:116161102-116161124 GAATGGTCACATGTGGCTAGTGG + Intronic
961614260 3:128166469-128166491 ATATAGGCACAGGTGGCTAGTGG + Intronic
961919280 3:130408921-130408943 AAATAATCACATGTGGTTAGTGG - Intronic
962040231 3:131699372-131699394 AAATAATCACATGTGGCTAGTGG + Intronic
962519155 3:136182268-136182290 AAATTGTCACATATGGCTAGTGG + Intronic
962925113 3:139985943-139985965 AAATAGCCACATGTGGCTAGTGG + Intronic
963228244 3:142884889-142884911 CAATAGCCACATGTGGATAGTGG - Intronic
963388097 3:144622509-144622531 ATATTGTTATAGGTGGATATTGG + Intergenic
963479364 3:145851490-145851512 ATATTGTCACCTTTCCATAGAGG - Intergenic
963812770 3:149795728-149795750 ATACTGTCATATGTGGAGGGAGG - Intronic
963938731 3:151080334-151080356 CAATAGTCACATGTGGCTAGTGG - Intergenic
964094291 3:152913572-152913594 AACTAGTCACATGTGGTTAGTGG + Intergenic
964098325 3:152959805-152959827 ATATAGTCACATGGGTATATAGG - Intergenic
964351484 3:155807352-155807374 ATTTAGTCACATATGGCTAGTGG + Intergenic
964863112 3:161223264-161223286 ATGTTGCCACATGTGGCTAGTGG + Intronic
965432318 3:168604952-168604974 TGATTGTCACATGTGGCTTGTGG - Intergenic
965611119 3:170545068-170545090 AAATAGTCACATGTGGCCAGTGG + Intronic
967302558 3:188030109-188030131 ATATTGCCTCCTGGGGATAGGGG - Intergenic
968327583 3:197833189-197833211 TAATTATCACATGTGGCTAGTGG - Intronic
969111357 4:4846255-4846277 ATCTTTGCACATGTGGAGAGGGG + Intergenic
970020661 4:11564006-11564028 ATATGGCCACATGTGGCTAGGGG + Intergenic
970570411 4:17375915-17375937 CAATGGTCACATGTGGCTAGGGG - Intergenic
970570418 4:17376000-17376022 AAATATTCACATGTGGCTAGTGG + Intergenic
971328974 4:25666536-25666558 AAACTGCCACATGTGGCTAGTGG - Intronic
972757293 4:42061325-42061347 AAATTGCCACATGTGGCTAGTGG + Intronic
972986925 4:44776259-44776281 AGATTGTGACATGAGAATAGAGG + Intergenic
973174151 4:47183669-47183691 ATATTGACAGATGTAGAAAGAGG - Intronic
973644345 4:52935064-52935086 AAATAGCCACATGTGGCTAGTGG + Intronic
974719517 4:65719466-65719488 ATAATGTCACATGATGAAAGGGG + Intergenic
975103548 4:70542171-70542193 TGATAGTCACATGTGGCTAGTGG + Intergenic
975356008 4:73405439-73405461 ATATAGTCACATGTGGCTAATGG + Intronic
975712668 4:77176093-77176115 ATATTGTTAAATGAGGAAAGTGG - Intronic
975889894 4:79015149-79015171 CAATAGTCACATGTGGCTAGTGG - Intergenic
976391343 4:84507546-84507568 ATATAGTCACATGTGACTAATGG - Intergenic
977471182 4:97445648-97445670 AAATAGTCACATGTGGCTAGTGG + Intronic
977595043 4:98869635-98869657 AAGTAGCCACATGTGGATAGTGG + Intergenic
977658645 4:99555744-99555766 CAATAGCCACATGTGGATAGTGG + Intronic
980269450 4:130564793-130564815 ATTTAGTCACATCTGGCTAGTGG + Intergenic
981104505 4:140865086-140865108 GGATAGTCACATGTGGCTAGTGG - Exonic
981840465 4:149105711-149105733 ATATTTTCTCATTTGGGTAGAGG + Intergenic
982302076 4:153889991-153890013 AAATCATCACATGTGGCTAGTGG + Intergenic
983528737 4:168787489-168787511 AAATAGCCACATGTGGTTAGTGG - Intronic
984156012 4:176196880-176196902 AAATAGCCACATGTGGCTAGTGG - Intergenic
984724068 4:183003215-183003237 ATATTGCCACATGGGCATGGAGG - Intergenic
984800483 4:183711247-183711269 CAATAGTCACATGTGGCTAGTGG - Intronic
984825259 4:183918759-183918781 ATATTAACACATGTGAAGAGTGG - Intronic
985130810 4:186736984-186737006 ATATTTTCACATTTTAATAGAGG - Intergenic
988295383 5:29353406-29353428 ATATTGTGACATTAGAATAGAGG + Intergenic
988341019 5:29972070-29972092 AAATAGCCACATGTGGCTAGTGG + Intergenic
988611901 5:32734808-32734830 ATAGTCACACATGTGGCTAGTGG + Intronic
988916278 5:35896593-35896615 AAATAGCCACATGTGGCTAGTGG - Intergenic
989079911 5:37607580-37607602 AAATAGTCAAATGTGGCTAGTGG - Intronic
990435904 5:55791699-55791721 AAATTGTTACATGTGGCTAGTGG - Intronic
990963508 5:61419513-61419535 AAATAGCCACATGTGGCTAGTGG - Intronic
991161004 5:63502682-63502704 ATTTTCTCACTTGTGCATAGAGG + Intergenic
991527755 5:67580946-67580968 GTATAGACACATGTGGTTAGTGG - Intergenic
994236288 5:97367289-97367311 TTATGGCCACATGTGGCTAGTGG + Intergenic
994366704 5:98925898-98925920 AAATAGCCACATGTGGCTAGTGG + Intronic
995377139 5:111487711-111487733 CAATAGTCACATGTGGCTAGTGG + Exonic
995654955 5:114415444-114415466 ATATTGTCATATCTGGATATGGG + Intronic
996441043 5:123491214-123491236 ATATTTTAATATGTGGATTGTGG - Intergenic
996863233 5:128088463-128088485 AGATTATCAAATGTGGAAAGTGG + Intronic
997263550 5:132481595-132481617 AAATAGTCACATGTGGTCAGTGG - Exonic
997330909 5:133060957-133060979 AAATAGCCACATGTGGCTAGTGG + Intronic
998428493 5:142049977-142049999 TAATAGTCACATGTGGCTAGTGG - Intergenic
998833708 5:146184409-146184431 AAATTGCCACATGTGGCTAGTGG - Intergenic
999117842 5:149179741-149179763 AAATAGTCACATGTGATTAGTGG - Intronic
999122388 5:149219253-149219275 ATATTGCCACATGTCCCTAGGGG + Intronic
999358666 5:150962715-150962737 AGATTGTGACATGAGAATAGAGG + Intergenic
999451339 5:151680556-151680578 AAATAGCCACATGTGGCTAGTGG + Intronic
999817891 5:155196128-155196150 AAATCGCCACATGTGGGTAGTGG - Intergenic
1000191081 5:158911436-158911458 AAAATGTCTCATGAGGATAGAGG + Intronic
1001744182 5:174078014-174078036 ATATAGCCACAGGTGGCTAGGGG - Intronic
1001814226 5:174654533-174654555 ATTTTGGCACATGTGGAGATGGG - Intergenic
1004191298 6:13466108-13466130 AAAATGTCCCATGTGGATACAGG + Intronic
1004738249 6:18430134-18430156 AAATAGCCACATGTGGCTAGTGG - Intronic
1005100057 6:22161983-22162005 AAATAGCCACATGTGGCTAGTGG + Intergenic
1005322719 6:24670903-24670925 AGATTGTTACATGAGAATAGAGG - Intronic
1007224576 6:40303656-40303678 AAAATGCCACATGTGGCTAGTGG - Intergenic
1007712649 6:43834582-43834604 AAATGGCCACATGTGGCTAGTGG + Intergenic
1007871599 6:45045676-45045698 ATATTTTCACATGTGCTTACTGG + Intronic
1008873544 6:56301672-56301694 AAATAGCCACATGTGGTTAGTGG - Intronic
1010455462 6:76049647-76049669 ATATTGACATTTGTTGATAGGGG + Intronic
1012121564 6:95373883-95373905 TTATTTTCCCATGTGGATATTGG - Intergenic
1012384885 6:98668840-98668862 AGATTGCCACATTTGGCTAGTGG + Intergenic
1012411279 6:98960257-98960279 ATTTTGTCAAGTGTGGATAATGG + Intergenic
1012617726 6:101297867-101297889 ATATTGTCACAGCTGAATATAGG - Intergenic
1015628877 6:135210811-135210833 ATAATATCACCTGTGTATAGTGG - Intronic
1015652162 6:135475666-135475688 ATTTTGTCACATGTTGTTGGAGG + Intronic
1016378314 6:143447256-143447278 AAATAGACACATGTGGTTAGTGG + Intronic
1016389214 6:143558313-143558335 ATATTTTTACATGTAAATAGGGG - Intronic
1016518241 6:144921299-144921321 AAATAGCCACATGTGGCTAGTGG + Intergenic
1016637561 6:146311565-146311587 AAATAGACACATGTGGCTAGTGG - Intronic
1016696242 6:146999818-146999840 AGATTGTCCCCTGGGGATAGGGG - Intergenic
1016696498 6:147002262-147002284 AAATAGTCACATGTGGTTAATGG - Intergenic
1017216369 6:151911950-151911972 AAATGGCCACATGTGGCTAGTGG - Intronic
1018264491 6:162007963-162007985 ATATTTTCAGATGTCGCTAGGGG + Intronic
1018376078 6:163214255-163214277 AAATAGCCACATGTGGCTAGTGG + Intronic
1018445463 6:163854062-163854084 ATATAGTCACATGGGGAGTGAGG + Intergenic
1020334883 7:7055633-7055655 AAATAGCCACATGTGGCTAGTGG + Intergenic
1020940115 7:14522593-14522615 ATATTGACACAACTGGAAAGGGG + Intronic
1021361501 7:19718588-19718610 AAATAGTCACATGTGGATAGTGG + Intergenic
1022626904 7:32045852-32045874 AGATTGTCACATGTGAAGGGAGG - Intronic
1022711524 7:32855268-32855290 AAATAGCCACATGTGGCTAGTGG + Intergenic
1022913133 7:34919691-34919713 AAATAGCCACATGTGGCTAGTGG - Intergenic
1026869796 7:73843316-73843338 AAATAGCCACATGTGGCTAGTGG + Intergenic
1029093716 7:98068623-98068645 AAATAGCCACATGTGGCTAGTGG - Intergenic
1029310780 7:99661852-99661874 AAATAGCCACATGTGGATAGTGG - Intronic
1031675521 7:124607032-124607054 ATATAGCCACATGTGGCTAGTGG - Intergenic
1031841938 7:126752858-126752880 ATATTGTCAGAGGAGGAGAGTGG - Intronic
1031922135 7:127609873-127609895 AAATAGTCACATGTGGTTGGTGG + Intergenic
1032692658 7:134304471-134304493 AAATAGTCACACGTGGCTAGTGG + Intronic
1034238454 7:149591088-149591110 ATGTTTTAAAATGTGGATAGAGG + Intergenic
1034241539 7:149615081-149615103 ACATTTTAAAATGTGGATAGAGG + Intergenic
1037403816 8:18520835-18520857 AAATTGTCACATGTGGTTAGTGG + Intergenic
1039298594 8:36184782-36184804 AAATTATCACATGTGGCTAGTGG + Intergenic
1040071843 8:43195100-43195122 AGATGGTCACTTGTGGCTAGTGG + Intronic
1040350200 8:46558667-46558689 TAATTGTCATATTTGGATAGTGG + Intergenic
1041171449 8:55146595-55146617 AAATAGTCACATGTGGCTAGTGG + Intronic
1042184066 8:66119797-66119819 AAATGTCCACATGTGGATAGTGG - Intergenic
1042650723 8:71038101-71038123 ATATTGTAACATTTTGTTAGAGG - Intergenic
1044141109 8:88654377-88654399 ATTTTGTCATCTGTGGATTGTGG + Intergenic
1044208900 8:89526105-89526127 AAATAGCCACATGTGGTTAGTGG + Intergenic
1044423684 8:92027176-92027198 AAATAGTCACATGTGGCTAGTGG - Intronic
1044526458 8:93257369-93257391 AAATAGTCACATGTGGTTAGTGG + Intergenic
1045043804 8:98254805-98254827 AAAGTGTCACATCTGGCTAGAGG - Intronic
1047235299 8:123036298-123036320 ATATTGTTGCATGTGGTTATAGG - Intronic
1047654162 8:126957877-126957899 ATATTGCCACATGTGAAGAGAGG + Intergenic
1048558165 8:135502888-135502910 AAATTGCCTCATGTGGCTAGAGG - Intronic
1049482140 8:142830882-142830904 ATTTTGTCCCATGTGGACACTGG - Intergenic
1051062688 9:13063034-13063056 AAATAGCCACATGTGGCTAGTGG + Intergenic
1051384162 9:16489332-16489354 AAATAGACACATGTGGCTAGTGG + Intronic
1055219098 9:73906748-73906770 AAATAGTCACATGTGGCTAGTGG + Intergenic
1055234085 9:74098807-74098829 AAATAGCCACATGTGGCTAGTGG + Intergenic
1055507314 9:76961641-76961663 AAATAGTCACATGTGGTTAGTGG + Intergenic
1056619895 9:88203307-88203329 CTATAGTCACGTGTGGAAAGTGG + Intergenic
1056661051 9:88543685-88543707 AAGTTGTCACAAGTGGCTAGTGG - Intronic
1057382474 9:94581608-94581630 ATTTTGTCCCATGTGGATGCTGG - Intronic
1058890470 9:109356507-109356529 AAATTGCCACATGAGGTTAGTGG - Intergenic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1186623970 X:11272212-11272234 AAATTACCACAGGTGGATAGTGG + Intronic
1186694114 X:12011378-12011400 AAATAGTCACATGAGGCTAGTGG - Intergenic
1186765115 X:12762837-12762859 ATTTGGACACATGTGGACAGAGG + Intergenic
1186862028 X:13682156-13682178 ATTTAGGCACATGTGGCTAGTGG - Intergenic
1187094197 X:16129311-16129333 AAATAGCCACATGTGGTTAGTGG - Intronic
1187312927 X:18163352-18163374 AAATAGCCACAAGTGGATAGTGG - Exonic
1187334429 X:18369802-18369824 AAATAGACACATGTGGCTAGTGG - Intergenic
1187941826 X:24390073-24390095 AAATAGCCACATGTGGTTAGTGG + Intergenic
1188741991 X:33795676-33795698 AAATAGTCACATGTGGCTAATGG - Intergenic
1188914945 X:35898882-35898904 AAATAGCCACATGTGGCTAGTGG + Intergenic
1189202996 X:39213880-39213902 AAATTGTCATGTATGGATAGAGG - Intergenic
1189579032 X:42386301-42386323 AAATAGCCACATGTGGCTAGCGG + Intergenic
1189999050 X:46667456-46667478 ATATAGCCACATGTGGCTAATGG - Intronic
1192219598 X:69188386-69188408 ATATTATCCCATATGTATAGAGG - Intergenic
1192300431 X:69895713-69895735 ATAAAGTCAAATGTGGAAAGTGG - Intronic
1192407835 X:70904689-70904711 CAATAGTCACATGTGGCTAGTGG - Intronic
1192426576 X:71082462-71082484 ATTTGGTCACTTGTGGCTAGTGG - Intergenic
1193737691 X:85179164-85179186 AAATAGCCACATGTGGCTAGTGG + Intergenic
1193973786 X:88091433-88091455 AGATTGTGACATGAGAATAGAGG - Intergenic
1195769976 X:108340346-108340368 AAATGGTCACATGTGGTTAATGG + Intronic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1196387839 X:115177612-115177634 AAATAGACACATGTGGCTAGTGG - Intronic
1197152943 X:123239832-123239854 GTGTAGTCACATGTGGCTAGTGG + Intronic
1197312445 X:124921769-124921791 CAATAGTCACATGTGGCTAGTGG - Intronic
1198829941 X:140739512-140739534 AAAGTTTCACATGTGGATGGGGG - Intergenic
1199716923 X:150513193-150513215 ATTTTGTCACAGGTAGAGAGAGG - Intronic
1200836384 Y:7736125-7736147 AAATAGCCACATGTGGCTAGTGG - Intergenic
1202031614 Y:20580854-20580876 ACATAGTCACATGCGGTTAGTGG - Intronic