ID: 1157587167

View in Genome Browser
Species Human (GRCh38)
Location 18:48810250-48810272
Sequence GTGGATAGTGGCTACCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2874
Summary {0: 3, 1: 118, 2: 393, 3: 905, 4: 1455}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157587164_1157587167 9 Left 1157587164 18:48810218-48810240 CCACACTTCAAGGGCTCAATATA 0: 1
1: 0
2: 4
3: 65
4: 431
Right 1157587167 18:48810250-48810272 GTGGATAGTGGCTACCATATTGG 0: 3
1: 118
2: 393
3: 905
4: 1455
1157587161_1157587167 27 Left 1157587161 18:48810200-48810222 CCATATCAGTCGGGATAGCCACA 0: 1
1: 1
2: 0
3: 4
4: 48
Right 1157587167 18:48810250-48810272 GTGGATAGTGGCTACCATATTGG 0: 3
1: 118
2: 393
3: 905
4: 1455
1157587160_1157587167 28 Left 1157587160 18:48810199-48810221 CCCATATCAGTCGGGATAGCCAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1157587167 18:48810250-48810272 GTGGATAGTGGCTACCATATTGG 0: 3
1: 118
2: 393
3: 905
4: 1455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157587167 Original CRISPR GTGGATAGTGGCTACCATAT TGG Intronic
Too many off-targets to display for this crispr