ID: 1157591585

View in Genome Browser
Species Human (GRCh38)
Location 18:48839305-48839327
Sequence AAACCTTTGAAGCTACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157591585_1157591591 19 Left 1157591585 18:48839305-48839327 CCTGGCTGTAGCTTCAAAGGTTT 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1157591591 18:48839347-48839369 TGAGCCTCCTCTCCTGACCCAGG 0: 1
1: 0
2: 9
3: 98
4: 973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157591585 Original CRISPR AAACCTTTGAAGCTACAGCC AGG (reversed) Intronic
901822089 1:11836796-11836818 AAACCACAGAAGCTGCAGCCAGG + Intronic
903202359 1:21752425-21752447 AAACCACTAAAGCTACAACCTGG + Intronic
903228805 1:21909618-21909640 GACCCTTTGAAGCTGAAGCCAGG + Intronic
905195365 1:36272176-36272198 AAACATTTAAAGATACAGGCTGG - Intronic
906180774 1:43816850-43816872 AAACCTTTGCAGCTAGAGGCAGG - Intronic
906872832 1:49503178-49503200 TACCCTCTGAAGATACAGCCTGG - Intronic
909377937 1:74961386-74961408 GAAACTTTGGAGCCACAGCCAGG - Intergenic
909975707 1:82043857-82043879 AAACTTTTGAAGCCAAAGACTGG + Intergenic
912776602 1:112509528-112509550 AACCCGTCGAAGCAACAGCCTGG - Intronic
913476944 1:119246677-119246699 AGCCCTTTGAAGCTCCAGTCAGG - Intergenic
915580441 1:156809744-156809766 AAACTTTGGAAGCAAAAGCCAGG - Exonic
917801778 1:178577966-178577988 AAACCCATGAAACCACAGCCAGG - Intergenic
918616578 1:186551035-186551057 CAACCTGTGAGGCTGCAGCCGGG - Intergenic
918766907 1:188498748-188498770 AAAGCATTGAAGATGCAGCCTGG + Intergenic
919377963 1:196817657-196817679 CAACCTGTGAGGCAACAGCCTGG - Intergenic
919387650 1:196941694-196941716 CAACCTGTGAGGCAACAGCCTGG - Intronic
920918698 1:210279919-210279941 AAACCTTGGAAGCTAAGTCCTGG - Intergenic
922068318 1:222166165-222166187 AAAGCTTTCATGCTAAAGCCAGG + Intergenic
923438117 1:233988265-233988287 ATACCTTTTAAGCAAGAGCCTGG - Intronic
923919352 1:238546198-238546220 CACCCTCTGAGGCTACAGCCAGG + Intergenic
1063980635 10:11449008-11449030 AAGCCTTTGAAAATACACCCAGG + Intergenic
1064298458 10:14100270-14100292 AATTCTTTGAAGCTCCAGCATGG - Intronic
1064749985 10:18518610-18518632 AAATCTTCAAAGCAACAGCCAGG - Intronic
1065157033 10:22881046-22881068 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1065834391 10:29643821-29643843 ATTGCTCTGAAGCTACAGCCCGG - Intronic
1067911439 10:50350654-50350676 CACCCTCTGAAGCCACAGCCCGG - Intronic
1069714406 10:70511350-70511372 GAGCCCTTGAAGCCACAGCCTGG - Intronic
1069738173 10:70670981-70671003 AGAGCTGTGAAGCTCCAGCCTGG + Intergenic
1069907502 10:71740436-71740458 AGGCCTTTGAAGCTAAAGACAGG + Intronic
1070428154 10:76309282-76309304 GCACCTTTGAAGCTTCAGTCAGG + Intronic
1071044818 10:81361143-81361165 AAACCTCTGTGGCTCCAGCCTGG - Intergenic
1072447849 10:95515192-95515214 AAACCTTTGAGGGGATAGCCAGG + Intronic
1075412440 10:122238900-122238922 AAATCATTTAAGCTACAGTCAGG - Intronic
1078690007 11:13570236-13570258 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1079653993 11:22965636-22965658 CAACCTGTGAGGCTGCAGCCTGG - Intergenic
1079840010 11:25384688-25384710 AAACTTGAGAAGCTACAGACTGG + Intergenic
1080860810 11:36148739-36148761 AGACCTTTGAAGATATAGCTTGG - Intronic
1085338725 11:75717684-75717706 AAACCTTTGAATCTACCTGCTGG - Intergenic
1088014595 11:105043698-105043720 AATCCCTTGAACCTACAGCATGG - Intronic
1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG + Intronic
1094824523 12:34259207-34259229 AAATTTTTATAGCTACAGCCAGG - Intergenic
1095081579 12:38005964-38005986 AAACCTTTGATTCTACAGGTTGG + Intergenic
1095086694 12:38064128-38064150 AAATTTTTATAGCTACAGCCAGG + Intergenic
1097568665 12:61303313-61303335 AAACATATGAAGCTTCACCCAGG + Intergenic
1098882571 12:75931219-75931241 AAACCTTTGCAGCTATAGATAGG - Intergenic
1099488497 12:83256953-83256975 AATCCTTTGAAGCCACTGCTGGG + Intergenic
1099995702 12:89775842-89775864 GAACCTCTGAAGGTGCAGCCTGG - Intergenic
1101182240 12:102231550-102231572 AAACATTTGAAGCAAAAGCATGG - Intergenic
1104190679 12:126479529-126479551 AAACCTTGGCATCTACACCCTGG + Intergenic
1107743209 13:43476550-43476572 AACCCTTAGAAGCTAAAGGCGGG + Intronic
1108910958 13:55550937-55550959 CACCCTCTGAAGCAACAGCCTGG - Intergenic
1109808206 13:67471356-67471378 AATCCTAAGCAGCTACAGCCTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112869862 13:103957125-103957147 AAACCTGTGATGCTGCAGACAGG + Intergenic
1114667400 14:24387435-24387457 AAACCTTTGATGCTAGGGACTGG - Intergenic
1114707031 14:24737756-24737778 AATCCTCTGAAGCTATGGCCTGG + Intergenic
1115743209 14:36409782-36409804 CAACCTGTGAGGCTACAGCCTGG + Intergenic
1116317923 14:43421498-43421520 CTTCCTTTGAAGCTACTGCCAGG + Intergenic
1117172785 14:53117562-53117584 CAACCTTTGAGGCTGTAGCCTGG + Intronic
1117802831 14:59463625-59463647 AAACATTTAAAGCTAGAGACGGG - Exonic
1118708651 14:68502247-68502269 GAGCCTTTGAAGCCACAGACAGG + Intronic
1119128424 14:72149946-72149968 AAAAATTTGAAGCCACAGCCAGG - Intronic
1121128820 14:91427205-91427227 AAACCTTGGCAGCTTCAACCTGG + Intergenic
1122015408 14:98791018-98791040 GAACCCTGGAAGCTACAGTCAGG + Intergenic
1124620434 15:31270925-31270947 CCACCATTGGAGCTACAGCCAGG + Intergenic
1132234331 15:100207756-100207778 ACACCTTGCAAGTTACAGCCAGG + Intronic
1134442905 16:14309864-14309886 AACCCTTTGAAGCCAGAGCAGGG - Intergenic
1134652130 16:15917842-15917864 CAACCTGTGATGCTGCAGCCTGG + Intergenic
1136172904 16:28499060-28499082 AAACCTCTGGAGCTGCATCCAGG + Intergenic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1139030632 16:62876498-62876520 AAAATTTTGAAGACACAGCCTGG - Intergenic
1140183463 16:72744597-72744619 TAATCTTTCAAGCTACAGCTGGG - Intergenic
1140881645 16:79203792-79203814 AAACCTTTGAAATTATTGCCAGG - Intronic
1143629324 17:8128669-8128691 AAACCTGTACAGCTACAGCATGG + Intergenic
1144066594 17:11629892-11629914 AAACGTTTGAAGCCACAGGGTGG - Intronic
1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG + Intronic
1150350182 17:64438260-64438282 CACCCTCTGAAGCAACAGCCTGG + Intergenic
1150757860 17:67931998-67932020 ACACCTGTGATGGTACAGCCAGG + Exonic
1153004187 18:482566-482588 TCACCTCTGAAGCCACAGCCTGG - Intronic
1155024935 18:21932722-21932744 CAACATTTGTAGCTACAGACTGG - Intergenic
1156421626 18:36960226-36960248 CAACCTATGAGGCTGCAGCCCGG + Intronic
1157191174 18:45582968-45582990 AAAGCTTTGATGCTAGACCCTGG - Intronic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1157627422 18:49062142-49062164 TAACCTTTGAAGATAAAGGCAGG - Intronic
1158737469 18:60099818-60099840 AAATCTGAGAAGGTACAGCCAGG + Intergenic
1159192791 18:65069772-65069794 ACACCATAAAAGCTACAGCCTGG + Intergenic
1162186623 19:8910063-8910085 AGACCTTAGAAGATCCAGCCTGG - Intronic
1164460340 19:28442208-28442230 AAACCCTTGAAACTAGAGGCTGG + Intergenic
1167810678 19:51827273-51827295 TAACCTTTGAGGCTAGAGGCAGG + Intergenic
927431170 2:23027437-23027459 ATACCTTTGAAGCAACATCTAGG + Intergenic
927980832 2:27374081-27374103 CCAGCTTTGCAGCTACAGCCTGG - Exonic
930147969 2:48026718-48026740 AAACTTTGGAAGATACAGTCTGG - Intergenic
931429814 2:62199232-62199254 AAACATTTAAAGCTAAGGCCAGG - Intronic
932593806 2:73081963-73081985 GAACCTTAGAAGCTTCAGCATGG - Intronic
933102815 2:78282060-78282082 CATCCTCTGAAGCCACAGCCTGG - Intergenic
933732615 2:85468956-85468978 TAGCCTTTGAAGCTAAAGACAGG + Intergenic
935933687 2:108157748-108157770 AAAGCGTTGAAGGTACAGCGTGG + Intergenic
936695714 2:114945517-114945539 AAACATTTGTAGCTTCGGCCGGG + Intronic
940037255 2:149323925-149323947 AAACTTTTGTGGCTGCAGCCAGG - Intergenic
940351158 2:152690078-152690100 AAATCCTTGAAGCTAAAGCATGG + Intronic
942064889 2:172261343-172261365 GAACCTTTAAAGCTAAAGACAGG - Intergenic
942065801 2:172270459-172270481 CAACCTGTGAGGCTGCAGCCTGG - Intergenic
942502403 2:176605449-176605471 AAACCTATGTCACTACAGCCAGG + Intergenic
943395541 2:187328687-187328709 CACCCTCTGAAGCCACAGCCTGG - Intergenic
943598288 2:189883620-189883642 AAATCTTTTAAACTAAAGCCGGG + Intronic
1168932590 20:1636104-1636126 CAACCTCTGGAGCAACAGCCTGG + Intronic
1169055858 20:2620152-2620174 AAAGTATTGAAGGTACAGCCTGG + Intronic
1170590048 20:17764999-17765021 AAACCATAGCAGCTACTGCCTGG + Intergenic
1172413819 20:34747497-34747519 AAAAATTTTAAGCTACACCCAGG - Intronic
1172599193 20:36171939-36171961 AAAGCTTTGAAGCTAAAACCAGG - Intronic
1173202181 20:40962219-40962241 CAACCTTTGGAGCTGCAGCCTGG - Intergenic
1176338913 21:5624675-5624697 AAGACTGTGAAGCAACAGCCTGG + Intergenic
1176340321 21:5687748-5687770 AAGACTGTGAAGCAACAGCCTGG + Intergenic
1176472575 21:7119901-7119923 AAGACTGTGAAGCAACAGCCTGG + Intergenic
1176504506 21:7636708-7636730 AAGACTGTGAAGCAACAGCCTGG - Intergenic
1179097274 21:38327119-38327141 ACACTTTTGATTCTACAGCCTGG + Intergenic
1181536453 22:23548783-23548805 AGTCCTTTGATGCTATAGCCAGG - Intergenic
1184301027 22:43561060-43561082 AAAACTTAGAAACTACAGGCTGG + Intronic
954777338 3:53031837-53031859 AAACCTGTGAACCTACTCCCAGG - Intronic
954917546 3:54161904-54161926 AAACCTTGGCACCTACAGCTGGG - Intronic
956538977 3:70312979-70313001 AAACCTTTAAAGCTACACTCTGG + Intergenic
956645028 3:71446931-71446953 AATCCATTGAAGCAACTGCCTGG - Intronic
957917857 3:86709092-86709114 CAACCTGGGAAGCTGCAGCCTGG - Intergenic
958099609 3:88991501-88991523 ATACCTTGGAAGGTACAGCTAGG + Intergenic
959313224 3:104768293-104768315 AAGCCTTTTCAGCAACAGCCAGG + Intergenic
959906319 3:111714601-111714623 AAGTATTTGAAGCTACAGCATGG - Intronic
960065397 3:113366978-113367000 CAACCTGTGAGGCTGCAGCCCGG + Intronic
962109211 3:132425390-132425412 AAACATTTTCACCTACAGCCAGG + Intronic
962291456 3:134140269-134140291 CAACCTGTGAGGCTGCAGCCTGG + Intronic
966446805 3:180009782-180009804 AAGCCCTTGAAGTTACATCCTGG - Intronic
971664075 4:29459315-29459337 AAACCTGTCAAGCTAAAACCTGG - Intergenic
972196181 4:36656417-36656439 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
975961894 4:79919414-79919436 ACACCTTTGAAGACACACCCTGG - Intronic
978818071 4:112931646-112931668 AAATCTTTGAAACGCCAGCCTGG - Intronic
981320893 4:143389933-143389955 AAACTTTTAAAGCTAAATCCAGG - Intronic
986201003 5:5578271-5578293 AAACCTGTGAAGTTGCAACCGGG - Intergenic
988456922 5:31394888-31394910 AAACTTTTGTGGCTATAGCCGGG + Intergenic
988699852 5:33662627-33662649 AAGCCCTTGAAGCTGCAGGCTGG - Intronic
992738357 5:79746260-79746282 AAAACTTTGGAGATACAGCAAGG + Intronic
995942025 5:117598234-117598256 GAGCTTTTGAAGATACAGCCCGG + Intergenic
998611222 5:143691312-143691334 ACACCTTTGAAACTGCAGACTGG - Intergenic
999541789 5:152582444-152582466 CAACCTTTCAAGCTTCAACCAGG - Intergenic
1001361511 5:171090772-171090794 CACCCTCTGAAGCAACAGCCCGG - Intronic
1003045053 6:2726351-2726373 AAACCCTTAAAGCTACTTCCTGG - Intronic
1004258154 6:14084114-14084136 AAATCCTTGAAGCTCCTGCCTGG + Intergenic
1012418480 6:99035912-99035934 AAAGATGTGAAGCCACAGCCTGG - Intergenic
1012625816 6:101402360-101402382 AAAACTTTGCAGTTACACCCAGG + Intronic
1013342157 6:109225470-109225492 AATCCTTTGAAGCTGCAACATGG + Intergenic
1021224943 7:18015455-18015477 AAACCTTTGAATCTGCAACCTGG - Intergenic
1021870553 7:25001998-25002020 CAACCTATGAGGCTGCAGCCTGG - Intergenic
1025996503 7:66530659-66530681 AAACCTCAGAAGCAACAGCAGGG + Intergenic
1026988561 7:74570060-74570082 AAACCTCAGAAGCAACAGCAGGG + Intronic
1028344237 7:89760629-89760651 AGACCTTAGCAGCTACAGCAAGG + Intergenic
1029949490 7:104567992-104568014 ACATCTTTGAACCTACAGCATGG - Intronic
1032635194 7:133699298-133699320 AAACCATTGCAGGTACAGACTGG - Intronic
1034756749 7:153628985-153629007 TAACCTTTAAAGCTTCAGCCTGG + Intergenic
1036567402 8:9949215-9949237 GAACCTTTGAGGCTACAGCAAGG - Intergenic
1036592713 8:10183482-10183504 AGGCCATTGAAGCTACAGTCAGG + Intronic
1038873298 8:31519849-31519871 CAACCTGTGAGGCGACAGCCTGG - Intergenic
1042038801 8:64569245-64569267 AACCCTTAGATGCTCCAGCCAGG - Intergenic
1044653002 8:94518344-94518366 AAACCTGTTAAGATACAGCTAGG + Intronic
1046775922 8:118163578-118163600 AAACCTGGGGAGCTTCAGCCGGG + Intergenic
1052559366 9:30064682-30064704 ATACATTAGAAGCTTCAGCCTGG + Intergenic
1053477625 9:38393510-38393532 AAACCTTTGCAGCCACACCAAGG - Intronic
1055229358 9:74043015-74043037 AAACCTTGGCAGATAGAGCCAGG + Intergenic
1055914948 9:81391483-81391505 AAACATACAAAGCTACAGCCCGG + Intergenic
1056668079 9:88597712-88597734 CAACCTGTGAGGCTGCAGCCTGG + Intergenic
1058035388 9:100246935-100246957 AAACCTTTGGAGTGACATCCTGG - Intronic
1058275375 9:103035380-103035402 AAACTTTGGAAGCTATTGCCAGG - Intergenic
1061245393 9:129398936-129398958 AGTCCTTTGATGCTATAGCCAGG + Intergenic
1203422746 Un_GL000195v1:10245-10267 AAGACTGTGAAGCAACAGCCTGG - Intergenic
1186503204 X:10068580-10068602 AAGCCTTAGAAGCTATGGCCAGG + Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188968228 X:36580798-36580820 ACACTTTTAAAGCTACAGCATGG + Intergenic
1194829758 X:98607969-98607991 AAACATTTGAAACTAAAGCAAGG + Intergenic
1195059921 X:101184176-101184198 AAACTTTTGAGGCTGTAGCCGGG + Intergenic
1195808372 X:108801219-108801241 CAACCTGTGAAGCTGCAGCCTGG + Intergenic
1196167465 X:112551485-112551507 CGACCTGTGAGGCTACAGCCTGG - Intergenic
1196795050 X:119495562-119495584 AAACCTTGAAACTTACAGCCAGG - Intergenic
1197781253 X:130162738-130162760 AAACATTTGAACCTAAAGTCAGG + Intronic
1198079276 X:133223738-133223760 AAGAATTTGATGCTACAGCCTGG + Intergenic
1198344495 X:135746466-135746488 AAACCTTTGTAGCTGTAGCTGGG - Intergenic
1199475289 X:148238423-148238445 AAGCCCCTGCAGCTACAGCCAGG - Intergenic