ID: 1157593702

View in Genome Browser
Species Human (GRCh38)
Location 18:48851195-48851217
Sequence GGCCCCAGGAGCCTGCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 524}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157593686_1157593702 23 Left 1157593686 18:48851149-48851171 CCTCTGCCCTGACAGGAGTTGGG 0: 1
1: 0
2: 2
3: 56
4: 645
Right 1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG 0: 1
1: 0
2: 2
3: 51
4: 524
1157593690_1157593702 17 Left 1157593690 18:48851155-48851177 CCCTGACAGGAGTTGGGGGAGTA 0: 1
1: 0
2: 1
3: 19
4: 149
Right 1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG 0: 1
1: 0
2: 2
3: 51
4: 524
1157593691_1157593702 16 Left 1157593691 18:48851156-48851178 CCTGACAGGAGTTGGGGGAGTAG 0: 1
1: 0
2: 3
3: 34
4: 326
Right 1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG 0: 1
1: 0
2: 2
3: 51
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157593702 Original CRISPR GGCCCCAGGAGCCTGCCTGC GGG Intronic
900140588 1:1137920-1137942 GGACCCCTGAGCCTGCCAGCAGG + Intergenic
900141792 1:1141792-1141814 GGGCCCAGGTGCCTGTCTCCTGG - Intergenic
900266668 1:1760585-1760607 GTCCCCAGCAGCCTGCGCGCTGG + Intronic
900294126 1:1940158-1940180 GGCCAGAGGGGCTTGCCTGCTGG - Intronic
900320506 1:2081309-2081331 TGCCCCAACAGCCAGCCTGCAGG - Intronic
900380189 1:2380090-2380112 GTCCCCAGAAGCCTCCATGCTGG - Intronic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900548334 1:3241205-3241227 GGCCCCAGCGCCCTGCCTGCAGG + Intronic
900658235 1:3770673-3770695 GGCCCCAGGAACGTGGGTGCTGG - Intronic
900782426 1:4626757-4626779 GGCCCCAGGTGCAGGGCTGCAGG + Intergenic
901056639 1:6451433-6451455 GGGCCCTGAAACCTGCCTGCAGG + Intronic
901175726 1:7297597-7297619 GGCCCTAGAAGTCTGCCTGGAGG - Intronic
901180995 1:7341836-7341858 GGCTCCAGGAGCTGGCCTCCTGG + Intronic
901462651 1:9400809-9400831 TCCCCCAGGAGGCAGCCTGCAGG - Intergenic
901463193 1:9404040-9404062 GCCCACAGGAGTCTGCCTTCTGG - Intergenic
901494423 1:9613142-9613164 GGCCTCAGGACCCTCCCTGGAGG + Exonic
901841080 1:11954649-11954671 GACCCCAGGAGCTTGGCTGCTGG + Intronic
901854737 1:12037542-12037564 AGCCACAGGAGCCTGCCCCCTGG + Intergenic
902645612 1:17795980-17796002 GGCCCCAGGGGACTTCCTGAGGG - Intronic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
902934967 1:19758491-19758513 GCACCCAGCAGCCTGCATGCTGG - Intronic
902994520 1:20213275-20213297 GAGCCCAGGAACCTGCCTTCAGG - Intergenic
903813233 1:26046279-26046301 GGCCCGCGGAGCCCACCTGCCGG + Intergenic
903856701 1:26342136-26342158 CCCCCCAGGAGCCAGCATGCAGG - Intronic
905019766 1:34800959-34800981 GGTCATAGAAGCCTGCCTGCAGG + Intronic
905480162 1:38256310-38256332 GGCTCCAGGTGTTTGCCTGCAGG - Intergenic
905522426 1:38610550-38610572 GCCTTCAGGGGCCTGCCTGCTGG + Intergenic
905865132 1:41372406-41372428 TCCCCCAGGAGCCAGCCTGCAGG + Intronic
906290112 1:44614307-44614329 CTCCCAGGGAGCCTGCCTGCTGG + Intronic
906642081 1:47447232-47447254 AGCCCCTGCAGCCTGCCTGGGGG + Intergenic
906665908 1:47621845-47621867 TGCCCCACTAGCCTGCCTGCTGG - Intergenic
906809327 1:48810163-48810185 GTCCCCAGGAGCCAGCCTCAAGG - Intronic
907299955 1:53480851-53480873 GGCCCCAAGAGCCCGCCCCCTGG - Intergenic
907787144 1:57623663-57623685 GGCCACAGAAGCCTGTCTGCAGG - Intronic
911807941 1:102234955-102234977 GGCCTCAGCCGCCTCCCTGCGGG - Intergenic
911975404 1:104488546-104488568 GGCCTCAGGACTCTGCCTGGTGG - Intergenic
912467333 1:109883085-109883107 GGCCCCAGGCCCCTCCCTGCTGG + Intergenic
912500947 1:110121548-110121570 GGCCCTTGGAGCCGTCCTGCTGG + Intergenic
912806241 1:112759049-112759071 GGACCCAGGAGCCCGCTGGCAGG + Intergenic
912972233 1:114294354-114294376 AGCCCTAGGAGGCTGACTGCTGG + Intergenic
913344464 1:117794212-117794234 TGCCCCAGGAGACTGAGTGCTGG - Intergenic
915571479 1:156747324-156747346 GGACCCAGGTGCCAGACTGCAGG - Intronic
915622317 1:157093095-157093117 TGCCCCAGGCCCCTGCCGGCTGG - Exonic
915908986 1:159900448-159900470 GGCCCCAGGAGCCTGGCCCAGGG + Intergenic
917966594 1:180182875-180182897 GGCCCAATGCTCCTGCCTGCGGG - Intronic
918047384 1:180949591-180949613 GGTGCCAAGAGCCAGCCTGCGGG - Exonic
918078760 1:181190135-181190157 GGCCCCAGCAGCCCCGCTGCGGG - Intergenic
919086560 1:192927723-192927745 GGTGCCAGCAGCCTCCCTGCTGG - Intergenic
920921998 1:210305336-210305358 AGCCTCACGTGCCTGCCTGCTGG + Intergenic
921345971 1:214185502-214185524 GGCTGCAGCAGCCTCCCTGCTGG - Intergenic
922166120 1:223117099-223117121 GGCCTCAGCCGCCTGCCTGCAGG - Intronic
922183986 1:223258019-223258041 GTCCCCTGCAGCCTGCCTCCAGG + Intronic
922475467 1:225904448-225904470 AGCCCCAGGCCCATGCCTGCAGG + Intronic
922675610 1:227547232-227547254 GGGCTCAGGAGGCTGCCTGCTGG + Intergenic
922706304 1:227792555-227792577 GGGCACTGGAGCCTGGCTGCAGG - Intergenic
923462585 1:234219960-234219982 TGGCCCAGTAGACTGCCTGCTGG - Intronic
923611975 1:235504125-235504147 GGCCCCAGGACCTCACCTGCAGG + Exonic
924947132 1:248854130-248854152 GGACAGAGGAGCATGCCTGCCGG - Intronic
1063145323 10:3290539-3290561 GAACCCAGGTTCCTGCCTGCTGG + Intergenic
1063448405 10:6134685-6134707 GGGCCCAGGAACCTGGCAGCAGG - Intergenic
1064011828 10:11742222-11742244 AACCCCTGGAGCCGGCCTGCAGG + Intergenic
1064704659 10:18059421-18059443 GGCTGCAGGAGTCAGCCTGCCGG - Intergenic
1065219327 10:23480138-23480160 GGCCCAATGAGCATGCCTCCAGG - Intergenic
1066013784 10:31217729-31217751 GGGCCCCTGAGCCTGCCCGCTGG + Intergenic
1066590546 10:36989435-36989457 GGCCTCAGCTGCCTCCCTGCAGG - Intergenic
1067089774 10:43260611-43260633 GGGCACGGGAGTCTGCCTGCTGG - Intronic
1067437623 10:46289121-46289143 TGACCAAAGAGCCTGCCTGCAGG - Intronic
1068211349 10:53924399-53924421 GGCCTCAGCTGCCTCCCTGCGGG + Intronic
1069090792 10:64196917-64196939 GGCCCCAGCTGCCTCCCCGCAGG - Intergenic
1069867145 10:71511020-71511042 GACCCCAGGAACATGCCTCCAGG - Intronic
1069976332 10:72216191-72216213 ACCCCCAGGATCCTACCTGCAGG + Exonic
1070553185 10:77507530-77507552 GGAGCGTGGAGCCTGCCTGCAGG - Intronic
1070736513 10:78867021-78867043 GGCAGCAGGAGCCTGGGTGCTGG - Intergenic
1070753053 10:78975117-78975139 GGACCCCGCAGCCAGCCTGCTGG - Intergenic
1073043485 10:100622653-100622675 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1073297694 10:102450945-102450967 CGGCCCGGGAGCCTGCATGCGGG - Exonic
1074356161 10:112785244-112785266 CTCCCCAGGAGCCTTCCTGAAGG + Intronic
1075115292 10:119621027-119621049 GGCCCCAGGAGCATCCCTTGGGG + Intergenic
1075334272 10:121597582-121597604 GACCCCGGGAACCGGCCTGCGGG + Intronic
1075612360 10:123864040-123864062 GGCCCCAGGAGCCTGGGCTCTGG + Intronic
1075657856 10:124173852-124173874 GCCCCCTGGAGCCTCCCTCCAGG + Intergenic
1075782742 10:125027354-125027376 GGACCCAGGAGTCAGCCGGCCGG - Exonic
1075833968 10:125437235-125437257 GGCCCCGGGAGCCTGTCTCTGGG - Intergenic
1076317655 10:129553905-129553927 TTCCCCAGGAGCCTGCCAGTAGG - Intronic
1076527136 10:131118979-131119001 GGCCACATGAGCCTGCGTGGTGG - Intronic
1077011701 11:381661-381683 GGCCCCAGGGTCCTGCAGGCAGG + Exonic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1078012704 11:7585474-7585496 TGACCCAGGAGACTTCCTGCTGG - Intronic
1078100194 11:8325890-8325912 TCTCCCAGGAGCCTGCATGCAGG - Intergenic
1080896461 11:36452488-36452510 GGCCCCAGCCTGCTGCCTGCTGG + Intronic
1081047674 11:38296409-38296431 GGCCTCAGTCGCCTCCCTGCTGG - Intergenic
1081574156 11:44309102-44309124 CGCCCGAGGAGCCTCCCAGCCGG + Intronic
1081671142 11:44943350-44943372 TCCCCCAGGAGCCAGGCTGCAGG + Intronic
1081675523 11:44966849-44966871 GGCCCCTGGGCCCGGCCTGCTGG + Intergenic
1082162493 11:48900571-48900593 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1082243212 11:49892165-49892187 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1083815623 11:65130855-65130877 GTCCCTAGGGGCCTGCCTTCTGG + Intronic
1083995399 11:66269134-66269156 GGCCCCAGGAGCCGGGCTTCAGG - Intronic
1084641273 11:70427632-70427654 GGCCAGAGGAGCCGGCCTGCAGG - Intronic
1085458737 11:76680541-76680563 GGCCACAGGAGCCAGCATCCAGG + Intergenic
1085458811 11:76680924-76680946 AGCCCCGGGAGCCTGCGGGCTGG + Intergenic
1085623953 11:78057829-78057851 AGCCCAGGGAGCCTGCTTGCAGG + Intronic
1086103860 11:83128910-83128932 GGCCACAGGTGCCAGCCTGGTGG - Intergenic
1086697640 11:89863988-89864010 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1086708519 11:89980500-89980522 AGCCCCAGGACCCTGGCAGCGGG - Intergenic
1087018683 11:93580027-93580049 GGCCCCAAGAACCTTCCAGCAGG - Intergenic
1087567103 11:99874873-99874895 GGCTCCAGGAGCCTACTTGAAGG - Intronic
1089125028 11:116170836-116170858 GTGGCCAGGAGCCTGGCTGCTGG + Intergenic
1089630957 11:119783811-119783833 AGACCCAGGAGACAGCCTGCAGG - Intergenic
1090255383 11:125280284-125280306 AGCCCCAGGAGTCTGGGTGCAGG - Intronic
1090281053 11:125456156-125456178 GGCCCCAGGAGCCTCCCCAGCGG - Intronic
1090663087 11:128895513-128895535 GGCCCCAGGAACCAGCCCACTGG + Intronic
1090665708 11:128913875-128913897 GCCCCCAGGAAGCTGGCTGCCGG + Intronic
1091085776 11:132720267-132720289 TACCCCAGGAGCTAGCCTGCCGG + Intronic
1091262941 11:134248199-134248221 GGCCAAAGGAGCCCGCCTGGAGG + Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1092534403 12:9374820-9374842 CTCCCCAGCAGCCTGCCTCCTGG + Intergenic
1093177930 12:15934241-15934263 GGCCTCAGTAGACAGCCTGCGGG + Intronic
1094000168 12:25686469-25686491 GGCCTCAGCCGCCTCCCTGCGGG + Intergenic
1095709849 12:45276558-45276580 GGTCACAGGAGCCTCCCTGAGGG - Intronic
1096085951 12:48865245-48865267 GGCTGCAGAAGCCTGCCTGAAGG + Intronic
1096112947 12:49039983-49040005 GGCCCCAGGGGGCTGCCCGATGG + Exonic
1096648492 12:53050526-53050548 AGCCCCAGGTGCCTCACTGCAGG + Intronic
1096657002 12:53098097-53098119 CTCCCCAGGACCCTGCCTGGAGG - Intronic
1099190977 12:79561757-79561779 GGCCTCAGCCGCCTCCCTGCGGG + Intergenic
1099413694 12:82361560-82361582 GGCCTCAGCTGCCTCCCTGCGGG - Intronic
1099989929 12:89709931-89709953 GGGCCCAGGAGCGAGCCAGCGGG + Intergenic
1101589798 12:106115656-106115678 TGCTCCACAAGCCTGCCTGCTGG + Intronic
1103394552 12:120597665-120597687 GTTCCCAGGAGCCTCCCGGCAGG - Intergenic
1103860767 12:124011602-124011624 ACCCCGAGGAGCCTGCTTGCTGG + Exonic
1103910307 12:124348480-124348502 GGCCCTGGGGGCCTGCCAGCAGG + Intronic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1104148193 12:126055583-126055605 GGAGCCAGCAGCCTTCCTGCTGG + Intergenic
1104595114 12:130115514-130115536 GTCCCCAGGGACCTTCCTGCAGG - Intergenic
1104639008 12:130455484-130455506 GGACCCTGGTCCCTGCCTGCTGG + Intronic
1104852376 12:131883431-131883453 GGCCCTAGGATCCAGCCTGGTGG - Intergenic
1104902150 12:132195242-132195264 TCCCCCAGCACCCTGCCTGCTGG - Intergenic
1104919027 12:132281003-132281025 GGCTGCAGGGGCCTGGCTGCAGG - Intronic
1105763145 13:23531676-23531698 GGCCTCAGCCGCCTCCCTGCGGG + Intergenic
1108359069 13:49652689-49652711 GGCCCCAGAAGCCTCCAAGCAGG - Intergenic
1108522747 13:51260064-51260086 GGCCCCAGGAGCCCTCCTCCCGG - Intronic
1109416435 13:62046681-62046703 GGCCTCAGCTGCCTCCCTGCCGG - Intergenic
1110425522 13:75362301-75362323 GTCCCCCGGAGACTGCCTGCCGG - Exonic
1112610215 13:100948093-100948115 AGCCCCAGGAGCAAGGCTGCTGG - Intergenic
1113485013 13:110646938-110646960 GGCCCCAGGAGACAGGGTGCTGG - Intronic
1113901479 13:113800637-113800659 GGGGCCAGGACCCTTCCTGCAGG - Intronic
1114566921 14:23639646-23639668 GGCCCCAGGAGCCTGCCCTTGGG + Intronic
1114614323 14:24060197-24060219 GCCCCCAGGAGCAGGCCTTCAGG + Exonic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1116297891 14:43136070-43136092 GGCCTCAGCCGCCTCCCTGCGGG - Intergenic
1116900971 14:50362100-50362122 GGCCTTAGGTGCCTCCCTGCAGG + Intronic
1117297464 14:54393126-54393148 GGCCTCAGCTGCCTGCCCGCAGG - Intergenic
1118011406 14:61614429-61614451 GCCCCCATGACCCTGCCTGAGGG + Intronic
1119147803 14:72332578-72332600 GGACCCAAGATCCTGCCTCCTGG - Intronic
1119760140 14:77144686-77144708 GTCCCCATGGGACTGCCTGCAGG - Intronic
1120723903 14:87916686-87916708 GGTCCCAGGGGCCGCCCTGCTGG + Intronic
1121016557 14:90552656-90552678 GTCCCCAGGAGCCACACTGCAGG - Intronic
1121231191 14:92359732-92359754 GCCCCCAGGAGCTTTCCTGCAGG + Intronic
1121950602 14:98167813-98167835 GGGCCCAGTGGCCTTCCTGCCGG + Intergenic
1122228222 14:100291904-100291926 ACCCCCGGGAGCCAGCCTGCAGG + Exonic
1122576614 14:102746924-102746946 GGCCCCAGGCAGCTGCCTGCTGG + Intergenic
1122657931 14:103274213-103274235 GGCCGCTGGAGGGTGCCTGCCGG - Intergenic
1124137591 15:27048496-27048518 AGCCCCAGCCACCTGCCTGCAGG - Intronic
1124211842 15:27770494-27770516 GGCTCCAGGACCCTCCCCGCAGG + Intronic
1124638029 15:31377249-31377271 GGCTCCAGGTGCCTGCCTCTGGG + Exonic
1124791398 15:32730836-32730858 CGCCCCAGCAGCCTGGCTCCAGG + Exonic
1124956938 15:34366334-34366356 AGCCCCTGGAGCCTGCCTCCGGG + Intronic
1125423682 15:39529192-39529214 GGCCCCAGATGCATGCATGCAGG - Intergenic
1125730231 15:41888910-41888932 GGCCCCAGTACCCTGCATGGTGG + Intronic
1126142286 15:45448419-45448441 GCCCCACAGAGCCTGCCTGCTGG + Intronic
1126997635 15:54462754-54462776 AGCCCGAGGAGCCTCCCTGACGG + Intronic
1127296728 15:57615062-57615084 GGCCCCAGGACTCTACCCGCTGG - Intronic
1128245153 15:66127856-66127878 GGCCCCAGCAGCCTGCCCTGAGG - Intronic
1128334462 15:66777287-66777309 GAGCCCAGCAGCCTACCTGCTGG + Intronic
1129236041 15:74224274-74224296 GGAGCCAGCAGGCTGCCTGCAGG - Intergenic
1129752870 15:78077826-78077848 GGTCGCAGGACCCTGCCTCCGGG - Intronic
1129881668 15:79010786-79010808 AGCCCCAGGAGCCTGGCAGGTGG + Intronic
1130049069 15:80468233-80468255 GGCCTCAGGAATCTCCCTGCTGG + Intronic
1130070640 15:80644205-80644227 GGAACCCGGAGGCTGCCTGCCGG - Intergenic
1130324674 15:82870337-82870359 GGCCCCAGAAGTCTGCCAGGGGG + Intronic
1130814879 15:87420759-87420781 GCCCCCAGTATGCTGCCTGCAGG - Intergenic
1130901092 15:88207234-88207256 GTCCCCAGGCACCTGCCTCCAGG + Intronic
1131850874 15:96542197-96542219 GACCCCAGCAGCCATCCTGCTGG + Intergenic
1131871935 15:96772634-96772656 TGTACCAGGAGCCTGCCTGGAGG + Intergenic
1132303160 15:100788916-100788938 GCATCCAGGAGCCTGCCTGGGGG - Intergenic
1132409997 15:101569423-101569445 GGCCGCATCAGCCTCCCTGCTGG + Intergenic
1132458155 16:35697-35719 GCCACCAGGAGCCTGGTTGCTGG + Intergenic
1132478061 16:152493-152515 GGTCCCAGGAGGCTGCTTACTGG + Intergenic
1132766574 16:1537398-1537420 ATCACCAGGAGCCTGCCTGAGGG + Intronic
1132772531 16:1572177-1572199 GGCCACAGGGGCGTTCCTGCAGG + Intronic
1132842722 16:1986138-1986160 GTCCCCAGGACACTGCCTGTGGG + Exonic
1132870560 16:2114014-2114036 AGCCCGAGGAGCCAGCCAGCAGG + Intronic
1132977882 16:2719640-2719662 AGCCCCAGCAGGCTGGCTGCAGG - Intronic
1133236395 16:4389255-4389277 GGGGCCGGGAGCCTTCCTGCTGG - Intronic
1133239350 16:4405216-4405238 GGCCAGAGGAGGCTGCCTGAGGG + Intronic
1133812263 16:9169879-9169901 GACCCCAGAAGCCTCTCTGCCGG - Intergenic
1134607660 16:15583715-15583737 GGCCCCAGGCAACTGCCTGCAGG - Intronic
1134607672 16:15583761-15583783 GGCCCCAGGCAACTGCCTACAGG - Intronic
1135322533 16:21506955-21506977 GGCCCCCGGGGACTGCCTCCAGG + Intergenic
1135561893 16:23483066-23483088 GGCCCCAGGAGCCTTCGATCAGG + Intronic
1136175758 16:28515135-28515157 GGTCCCAACAGGCTGCCTGCAGG + Intergenic
1136334012 16:29600093-29600115 GGCCCCCGGGGACTGCCTCCAGG + Intergenic
1137424451 16:48365882-48365904 TACTGCAGGAGCCTGCCTGCCGG + Exonic
1137808412 16:51329549-51329571 GTCCACAGTAACCTGCCTGCTGG - Intergenic
1139304241 16:65969591-65969613 TGCCCCAGGCTGCTGCCTGCAGG + Intergenic
1139373510 16:66482467-66482489 GGCTCCAGGAGGCTGCACGCAGG - Intronic
1140194534 16:72845582-72845604 TGCCCCAGGAGCCTGTGTTCTGG + Intronic
1141437312 16:84007546-84007568 GGCTCCTGTAGCCTGGCTGCTGG - Intergenic
1141715867 16:85726527-85726549 GGGCTCAGGCTCCTGCCTGCGGG - Intronic
1141909360 16:87047989-87048011 GGCCCCAGGGGCCTGTGTGCAGG - Intergenic
1142133710 16:88442319-88442341 CCCGCCAGGCGCCTGCCTGCAGG + Intergenic
1142140134 16:88469099-88469121 GGCCCCAGGGCCGTCCCTGCCGG - Intronic
1142286747 16:89174613-89174635 AGTCCCAGGAGCTTGGCTGCAGG + Intronic
1142500641 17:331103-331125 GCAGCCAGCAGCCTGCCTGCTGG - Intronic
1143010233 17:3862108-3862130 GTCCCCAGCCCCCTGCCTGCGGG + Intronic
1143119811 17:4599676-4599698 GGCCCCATGCCCCAGCCTGCAGG + Intronic
1143165938 17:4897333-4897355 GGCCCGGGAAGCCTGGCTGCAGG - Exonic
1143325725 17:6096919-6096941 GGCACTAGGAGCCTTCCTGCGGG + Intronic
1143335080 17:6166023-6166045 TGCCCCAGGAGCCAGTGTGCAGG - Intergenic
1143373677 17:6455283-6455305 GGCCCAATCAGGCTGCCTGCGGG - Exonic
1144512660 17:15890851-15890873 GGACCCAGGAGCCTATGTGCAGG + Intergenic
1144672449 17:17140609-17140631 GTGCCCAGGAGCCAGACTGCTGG + Intronic
1144872227 17:18378374-18378396 GACCCCTGGAGCCTGGGTGCAGG + Intronic
1145062008 17:19739464-19739486 GGCCCCAGGACCCTGGCAGAGGG + Intronic
1145811332 17:27765896-27765918 GGCCCCAGGAGCTTCCCTCTGGG + Intronic
1145975396 17:28981246-28981268 GGCACCAAGGGCCAGCCTGCAGG - Intronic
1145998942 17:29120178-29120200 GACCCCAGGTGCCTGCCTTCTGG + Intronic
1146211520 17:30947099-30947121 GGCTCCAGATTCCTGCCTGCAGG + Intronic
1147508729 17:41047042-41047064 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147509468 17:41054986-41055008 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147509976 17:41059825-41059847 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147510569 17:41065620-41065642 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147939343 17:44034883-44034905 TGCCCCAGGAGACTGCCTGAAGG + Exonic
1148189826 17:45670860-45670882 GGACCCAGGAGGTTGCCTGCTGG + Intergenic
1148205479 17:45777021-45777043 GGCCCCAGGCTCCTGCCTCCAGG - Intergenic
1148587437 17:48790956-48790978 GGCCCCAGGACGCTCTCTGCTGG + Intronic
1148691446 17:49529152-49529174 GGCCCCAGGGCCCAGGCTGCAGG - Intergenic
1148878637 17:50707885-50707907 GTCCCCCGGAGCCGGCCTTCGGG - Exonic
1149661065 17:58334089-58334111 GGACCCAGGAGCCCGGCTTCTGG + Intergenic
1150961791 17:69921495-69921517 CAGCCCAGGAGCCTTCCTGCAGG + Intergenic
1151149347 17:72070674-72070696 GGGCCCAGCAGCATGCCTGTGGG + Intergenic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151584994 17:75003509-75003531 GGCCTCAGGGGCCTGCGTGAGGG - Exonic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1151696840 17:75722187-75722209 AGCCCCAGGCGCCTTCCTTCAGG + Intronic
1151986643 17:77548151-77548173 GGCCCCAGGTGAGTGCCTGGAGG + Intergenic
1152021640 17:77782822-77782844 GGTGCCTGGAGCCTGCCAGCCGG + Intergenic
1152030711 17:77841065-77841087 GGCCCCACGGTCCTACCTGCTGG - Intergenic
1152250978 17:79212396-79212418 AGCGCCAGGAGCCCGGCTGCAGG - Intronic
1152361839 17:79836481-79836503 GCCACCAGGCTCCTGCCTGCAGG + Intronic
1152524056 17:80877261-80877283 GCTCCCAGGTTCCTGCCTGCGGG + Intronic
1152612410 17:81322353-81322375 GGCACCGGGAGCCAGGCTGCGGG - Intronic
1152882851 17:82830322-82830344 CGGCCCCGGAACCTGCCTGCCGG - Exonic
1153973424 18:10246549-10246571 GGCCCCAGGGGTCTGCAGGCTGG + Intergenic
1154123442 18:11669979-11670001 GGCCGGAGGGGCCAGCCTGCAGG - Intergenic
1154231423 18:12559231-12559253 GGCCTCAGCTGCCTCCCTGCGGG - Intronic
1155065432 18:22265179-22265201 GGACACAGGAGCATGACTGCTGG - Intergenic
1155233550 18:23796965-23796987 GGGGCCAGAAGCATGCCTGCTGG - Intronic
1156629040 18:38944545-38944567 GGCCTCAGCTGCCTCCCTGCAGG - Intergenic
1157198926 18:45642620-45642642 GTCCCCAGGAGCCAGGCAGCTGG - Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1158283290 18:55851081-55851103 CAGCCCAGCAGCCTGCCTGCAGG + Intergenic
1159124471 18:64207168-64207190 TGCCCCCAGAGCCTACCTGCTGG - Intergenic
1160007315 18:75076861-75076883 GGGCCCTGGAGCCTGGCTGCTGG - Intergenic
1160070671 18:75625180-75625202 GGCCCCAGGAGCTTGGCTTGTGG - Intergenic
1160122988 18:76147113-76147135 GGCCTCTGCAGCCTGCCAGCAGG + Intergenic
1160510037 18:79448277-79448299 GGCCCCAGCACCCTTCCTGATGG - Intronic
1160690948 19:460551-460573 GGCCCCAGGACCCTGGCGTCGGG + Exonic
1160738145 19:674136-674158 GGCCGCAGGGGCCAGGCTGCGGG + Intergenic
1160738564 19:675835-675857 GGCCGCTGGAGCCGGCCTGTGGG - Intergenic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160782153 19:882600-882622 GGCAGCTGGAGCCGGCCTGCTGG + Intronic
1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG + Intronic
1160921652 19:1523656-1523678 GGCCCCAGGGACCCGCCAGCAGG + Intergenic
1160979345 19:1809798-1809820 GGCCCCATGAGCCCTCCTCCGGG - Intronic
1160983325 19:1826630-1826652 GGCCACAGAAGCCTGGCTGGTGG + Intronic
1161349170 19:3783051-3783073 GGCCCCAGGGCCCTTCCTCCCGG + Intronic
1161576106 19:5055292-5055314 AGAGCCAGGAGCCAGCCTGCTGG - Intronic
1162091940 19:8285966-8285988 GGCCACAGTAGCCTCCTTGCAGG - Intronic
1162094177 19:8300815-8300837 GGCCACAGTAGCCTCCTTGCAGG - Intronic
1162946320 19:14046153-14046175 GGCCCCAGGGCCCTGTGTGCAGG + Exonic
1162958795 19:14114236-14114258 GTCCCCAGAACCCTGCCTGCAGG + Intronic
1163268191 19:16233951-16233973 GGCCTCAGCAGCCTGCTTGGGGG - Intronic
1164977124 19:32581506-32581528 GGGCCCAGGAGGCTGGCGGCGGG + Intronic
1165079579 19:33299691-33299713 GACCCCAAGAGACTGCCTTCAGG + Intergenic
1165121899 19:33565288-33565310 GGCCACAGAATTCTGCCTGCTGG - Intergenic
1165357372 19:35312319-35312341 GGCCCCCGGAACCTACCTCCTGG - Intronic
1166130622 19:40743746-40743768 GGCCCCAGGTGTCTGCCAGTTGG - Intronic
1166155454 19:40908400-40908422 GGGGCCAGGAGCGGGCCTGCGGG - Intergenic
1166357659 19:42236578-42236600 GGTCCCAGCAGCCCACCTGCTGG + Intronic
1166818884 19:45564261-45564283 GGTCTCAGCAGCCTCCCTGCTGG - Intronic
1167367081 19:49060192-49060214 GGCCCCAGAAGCCTGAATGGGGG - Intronic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1168020588 19:53606261-53606283 GCACCCAGGAGGCTGCATGCAGG + Intergenic
1168278401 19:55289662-55289684 GCCCCCAAGGGCCTGTCTGCTGG - Intronic
1168567282 19:57435646-57435668 GTCCCAAGGAGCCGCCCTGCAGG + Intronic
1168692833 19:58387070-58387092 GGCCCTAGAAGCGTGCCTGGCGG - Intronic
925073385 2:988673-988695 GCTCCCAGGAGTGTGCCTGCTGG + Intronic
925167681 2:1728325-1728347 GGCCCAGGGACCCTGCCAGCAGG - Intronic
925188517 2:1865298-1865320 GGCCGCAGGAGCAGGGCTGCTGG - Intronic
925317939 2:2939612-2939634 GGTTCCAGGAGCCGGTCTGCTGG - Intergenic
925397416 2:3545247-3545269 AGCCCCATGTGCCTGCTTGCTGG - Exonic
925540741 2:4964863-4964885 GGTCGCAGGAGCCCGCCTGGTGG + Intergenic
925860783 2:8173247-8173269 AGCCTCCGGAGCCTGGCTGCTGG + Intergenic
926920331 2:17934247-17934269 GGACCCAGGAGGCTGACTCCAGG + Intronic
927135650 2:20094345-20094367 GGACCCAGGAGCCTGAGAGCAGG - Intergenic
927296784 2:21463944-21463966 GGCCTCAGAAGCCTTACTGCAGG - Intergenic
927843973 2:26461960-26461982 GGCCCCACCAGCCTGGCTGCGGG - Intronic
927910497 2:26894704-26894726 GGCCCAAGGAGCATGGCTGAGGG - Intronic
928300035 2:30116871-30116893 GGCCCCAGGACTCTGGCTTCAGG - Intergenic
928599175 2:32886710-32886732 GGCCTCAGACGCCTTCCTGCGGG - Intergenic
932773562 2:74514540-74514562 GGCCCCTGGAGCTTCCTTGCTGG - Exonic
934603624 2:95678103-95678125 GGCCAGAGGACCCTGGCTGCTGG + Intergenic
934653293 2:96104371-96104393 GCCTCCTGGAGCCTGGCTGCTGG + Intergenic
935726004 2:106024564-106024586 GGCCCCAAGGCCCTGCCTGAGGG - Intergenic
936048161 2:109202629-109202651 GGCCCCAGGAACCTGGGTCCTGG + Intronic
936084179 2:109455271-109455293 GGCCCTAGGTGTCTGCCTTCTGG + Intronic
936537006 2:113320339-113320361 GGCCAGAGGACCCTGGCTGCTGG + Intergenic
937128245 2:119488103-119488125 GGCCCAAGGACTCTGCCTGCTGG - Intronic
937312679 2:120911758-120911780 GTCCACACGAGCCTGCCTCCAGG - Intronic
937341723 2:121095641-121095663 GGCCCCAGAAGCCAGGCTGCTGG + Intergenic
937825698 2:126366514-126366536 AGCTCCTGGAGGCTGCCTGCAGG + Intergenic
938378771 2:130825204-130825226 GGGCTGAGGAGCCTGCCTGTGGG - Intergenic
938382871 2:130846492-130846514 ACCCTCAGGAACCTGCCTGCGGG + Intronic
941846798 2:170141703-170141725 GGCCCCAGCAGGCTGGCGGCAGG + Intergenic
942454466 2:176128871-176128893 CCCCCCAGGAGCCTCCCAGCCGG - Intergenic
942620038 2:177835891-177835913 GGCCTCAGCTGCCTCCCTGCTGG + Intronic
946115854 2:217461447-217461469 GCCCACAGGAGACTGCTTGCTGG - Intronic
946253773 2:218429263-218429285 GTCACCAGGGGCCTTCCTGCAGG + Exonic
948402215 2:237692294-237692316 GGGGCCAGGAGCCAGCCCGCCGG - Intronic
948831928 2:240602500-240602522 GCGCCAAGGGGCCTGCCTGCAGG - Intronic
948868041 2:240785210-240785232 GACCCCAGGGGCCGCCCTGCTGG + Intronic
1168932177 20:1632720-1632742 GGTCCCAGGTGCCTGGCTGCAGG - Intronic
1170436595 20:16337090-16337112 GCCCACAGCAGCCTGTCTGCAGG + Intronic
1170614901 20:17940600-17940622 CGGCCCAGGAACCTGACTGCAGG + Intergenic
1170626443 20:18033669-18033691 GTCCCCAGGAGCGAGCATGCAGG - Intronic
1171179852 20:23084501-23084523 GCCCCCAGGAGCCTGCAGGTGGG - Exonic
1171181707 20:23095704-23095726 GGCTGCAGGAGCCAGCCTGGCGG - Intergenic
1171184648 20:23116721-23116743 GGACCCAGGAGGCAGCCTTCAGG + Intergenic
1171217280 20:23361780-23361802 GGCCCCAGCAGCCTGCGGTCAGG - Intergenic
1171468029 20:25345917-25345939 GTACCAAGGAGCCTGACTGCTGG - Intronic
1172278534 20:33694413-33694435 GGCCCATGAAGCCTGCCTGGTGG + Intergenic
1172587187 20:36092937-36092959 GGCTCCTGGAGCCGGCCCGCCGG - Intronic
1172740153 20:37160297-37160319 GGCCCCAGATGCCTGGCAGCAGG + Intronic
1172924055 20:38514270-38514292 GGACCCAGGAGCAAGCCTGCTGG - Intronic
1173146401 20:40528380-40528402 AGGCCCTGGAGCCTGCCTGAGGG - Intergenic
1173224654 20:41155195-41155217 GGCCCCAGGTGCCAGGCAGCAGG + Intronic
1173495285 20:43514040-43514062 GCCCCCAGGGGGCGGCCTGCGGG + Exonic
1173704232 20:45098345-45098367 GGCCCCAGTAGTCGGCCTCCTGG + Exonic
1174358721 20:50015096-50015118 GGCCGCTGGAGCCCGCCCGCAGG - Intergenic
1175444960 20:59013570-59013592 GGCTCCTGGAGCCTGCCTCTTGG + Intergenic
1175990563 20:62786444-62786466 GGGCACTGGGGCCTGCCTGCTGG - Intergenic
1176126840 20:63479319-63479341 GGCCCATGGCGGCTGCCTGCGGG - Intergenic
1176191798 20:63814646-63814668 GGCCTCAGGAGTCTGACTGTGGG + Intronic
1176244409 20:64090699-64090721 GGTGCCAGGGGCCTGTCTGCAGG + Intronic
1178054550 21:28783974-28783996 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1179302717 21:40126984-40127006 GGGCCCTGGAGCCTCACTGCTGG + Intronic
1179414734 21:41188974-41188996 GGCCACAGGAGCGAGACTGCTGG - Intronic
1179437125 21:41369669-41369691 TGCCCCTGGGGCCTTCCTGCAGG + Intronic
1179712952 21:43273548-43273570 GGCCCCAGGAGGCAGGCTGTAGG + Intergenic
1179976196 21:44868561-44868583 GGACCCAGAAGCCAGCCTGGAGG + Intronic
1180052174 21:45336205-45336227 GGCCCCTGGAGCCTTAGTGCAGG + Intergenic
1180219880 21:46351926-46351948 GGCCACAGGAGCCTGGCAGCAGG - Intronic
1180698572 22:17769605-17769627 GTCCCCAGGATCCTTCCAGCAGG - Intronic
1180841570 22:18961411-18961433 GGCCCCTGTTGCCTGTCTGCTGG - Intergenic
1180883765 22:19225082-19225104 GGCCCAAAGAGCCTCCCTCCTGG + Intronic
1180942498 22:19668487-19668509 GGCCCCACGATCCTGCCTCATGG - Intergenic
1181059918 22:20277382-20277404 GGCCCCTGTTGCCTGTCTGCTGG + Intronic
1181126008 22:20702822-20702844 CGCCCCAGGACCCTGTCCGCAGG + Intergenic
1181267057 22:21636548-21636570 TGACCAAGGAGGCTGCCTGCTGG - Exonic
1181450556 22:23017282-23017304 GGCCCGGGGGGCCTGCCGGCGGG + Intergenic
1181737296 22:24892091-24892113 GGCCCCAGCAGCCTCCATCCAGG - Intronic
1181803271 22:25360678-25360700 GGTCCCAGGACCGTGCCTGGGGG + Exonic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1182499930 22:30739365-30739387 GGCCCCAGGTGCCTCCCAGCAGG + Intronic
1182658174 22:31906151-31906173 GGCTCCAGGAGCCCTCCTGGTGG + Intronic
1182756376 22:32682960-32682982 GGCCACAGGTGCCTGGCTTCAGG - Intronic
1183055205 22:35300683-35300705 GGCACCTGGCGCCTGTCTGCTGG + Intronic
1183214026 22:36467696-36467718 GGCCCCAGGAGCCAGACAGGAGG + Exonic
1183361720 22:37386393-37386415 GGCTCCAGGACCCTGGGTGCTGG - Intronic
1183742538 22:39676918-39676940 GGACCCTGGGGCCAGCCTGCTGG + Intronic
1184291941 22:43502067-43502089 GGCTCCAGGAGGCTGGCAGCGGG + Intronic
1184509151 22:44921990-44922012 CACCCCACGAGCCTGCCTGATGG + Intronic
1184644851 22:45890119-45890141 GGCCCCAGGACCCTGCCTCTGGG - Intergenic
1184677916 22:46053676-46053698 GGCCCCAGGTGCCCGGCGGCCGG - Intronic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185012668 22:48323974-48323996 GACCTCAGAAGCCTGGCTGCAGG + Intergenic
1185214547 22:49590969-49590991 GGAGCCAGGCCCCTGCCTGCAGG + Intronic
1185273989 22:49942063-49942085 ACCCCAAGGAGCCTGCATGCTGG + Intergenic
949624748 3:5853204-5853226 GGCCTCAGGCTCCTGCCTGGTGG + Intergenic
950451283 3:13067186-13067208 ACCCCCAGGAGGCTCCCTGCAGG - Intronic
950537114 3:13585079-13585101 GGCCCCTGGAGCCTGGATGCAGG + Intronic
950721083 3:14883016-14883038 GAACCCAGGACCCTTCCTGCTGG - Intronic
952211202 3:31231115-31231137 TGCCCCAGGAGGCTGACTTCTGG - Intergenic
952746928 3:36790467-36790489 GGCCTGAGGAGCATGACTGCGGG - Intergenic
952963381 3:38606574-38606596 GGCCCCAGCAGCCTCCCCACTGG - Intronic
953019191 3:39103214-39103236 GGCCCAAGGGGCCTGCCTCCTGG - Intronic
954146066 3:48634943-48634965 GGCCCCAGTTGCCTTCCTACAGG - Intronic
954219585 3:49144871-49144893 GCCTCCATGAGCCTGCCTGGTGG + Intergenic
955038552 3:55292635-55292657 AGCCCCAGGAACCTGTCTGTAGG + Intergenic
956166352 3:66400856-66400878 GGTACCAGGAGGCTGCCTCCTGG + Intronic
956183926 3:66544799-66544821 GGCCTCAGCTGCCTCCCTGCGGG - Intergenic
961824896 3:129593893-129593915 GGCCCCAGGAGGGAGCCAGCTGG - Intronic
963089710 3:141471703-141471725 GGGCCCAGGGGCCTGGCTGCGGG - Intergenic
963228594 3:142888318-142888340 GGCCCCAGGAGCTGGGCTGTGGG - Intronic
963711528 3:148752886-148752908 AGCCCCATGAGCATGCCTTCAGG - Intergenic
963834371 3:150041488-150041510 GTCCCCAGGTTTCTGCCTGCAGG + Intronic
964582943 3:158260379-158260401 GGCCTCAGGATTCTGCCTGGTGG + Intronic
966178187 3:177162358-177162380 GGACAAGGGAGCCTGCCTGCCGG + Intronic
966985457 3:185175848-185175870 GGGCGCTGGGGCCTGCCTGCGGG - Intergenic
967968915 3:194985077-194985099 GGCCCCAGAGGTCTCCCTGCAGG - Intergenic
968641811 4:1718556-1718578 GGCCTCAGGGGCCTGGCTGAGGG + Exonic
968684841 4:1950989-1951011 GGCGGGACGAGCCTGCCTGCAGG + Intronic
968731569 4:2271596-2271618 AGCCACAGGAGCCTTCCTCCTGG - Intronic
968819952 4:2843343-2843365 GGCCCCCGGGCCCGGCCTGCGGG - Intergenic
968826266 4:2899923-2899945 GGCCCCATAAGCCCGCCTTCTGG - Intronic
969313781 4:6369683-6369705 GGCTCGAGGAGGCTGCCTGAGGG - Intronic
969529392 4:7722331-7722353 GGACCCAGGAGGCTGCTCGCTGG - Intronic
969569407 4:7999860-7999882 GGCCCCAAGAGCAGGCCTGGCGG - Intronic
969609088 4:8217035-8217057 TGCCCCCGAAGCCTGCCTGAGGG - Exonic
969610829 4:8227070-8227092 GCCCCCAGGAGCCAGCGTCCTGG + Exonic
969700309 4:8764314-8764336 GGCCCCAGGGCCCTGCACGCTGG + Intergenic
970615740 4:17766949-17766971 GGCCTCAGGTGCCTCCCCGCGGG - Intronic
975648484 4:76568645-76568667 GTCCCCAGGAGCCTGGCTTCAGG + Intronic
976850784 4:89542278-89542300 GGCCACAGGGTCCAGCCTGCAGG - Intergenic
980595418 4:134948293-134948315 GGCCTCAGCTGCCTCCCTGCAGG - Intergenic
980865933 4:138553362-138553384 GGCCCCAGCCGCCTCCCTGCGGG + Intergenic
983134958 4:164068572-164068594 GGCCTTAGGTGCCTCCCTGCGGG + Intronic
983262192 4:165469398-165469420 GGCCCCTGGAAGCTGCCGGCTGG + Intronic
983734731 4:171043377-171043399 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
984728673 4:183045287-183045309 GGCCTCAGCTGCCTCCCTGCAGG + Intergenic
985403585 4:189615358-189615380 GGCCTCAGCTGCCTCCCTGCAGG - Intergenic
985494874 5:198805-198827 GGGCCCAGGAGCACGCCTGCTGG + Exonic
985573345 5:662391-662413 GGCACCAGGACGCTGCCTCCTGG - Exonic
985578387 5:684216-684238 GGCCCCAGGACGCTGACTGAGGG + Intronic
985590902 5:764579-764601 GGCCTCAGCTGCCTCCCTGCGGG + Intronic
985593639 5:777964-777986 GGCCTCAGCCGCCTCCCTGCTGG - Intergenic
985720679 5:1487059-1487081 CTCCCCAGGGGCCTCCCTGCAGG + Intronic
985794107 5:1949414-1949436 GGCCTCAGTACCCTGTCTGCGGG + Intergenic
985824738 5:2183830-2183852 GCCCCCAGCAGCCTCCCCGCAGG - Intergenic
985952161 5:3230455-3230477 GGCAACAGGTGCCTCCCTGCTGG - Intergenic
986349966 5:6868227-6868249 GGCTCCAGAAGGCTGCGTGCTGG + Intergenic
986441537 5:7786963-7786985 GACCCCATGACCCTCCCTGCTGG - Intronic
986582909 5:9283651-9283673 GGCCCCAGGATTCTGCCCCCTGG - Intronic
986718049 5:10538164-10538186 GTCCCCAAGAGCCTCCCTCCAGG - Intergenic
987237443 5:15957295-15957317 GACCCCAGCAGCCACCCTGCAGG + Intergenic
987309353 5:16667541-16667563 GGTCCCAGGTGCCAGGCTGCAGG - Intronic
987350612 5:17018462-17018484 GCCCCCTGGAGAATGCCTGCAGG - Intergenic
987602803 5:20093997-20094019 GGCACCAGGAGTCTGCCTTTCGG - Intronic
988823777 5:34914911-34914933 GGCCCCAGGAGCATCCCTCGGGG - Exonic
990237229 5:53781343-53781365 GACCCCAGGCCCCTGCCTCCAGG + Intergenic
992050380 5:72935457-72935479 GGCCTCAGCCGCCTCCCTGCGGG + Intergenic
992813211 5:80409760-80409782 GTCCCCAGGAGCCTTTCAGCAGG - Intronic
994167028 5:96618730-96618752 GGCCTCAGCTGCCTCCCTGCAGG + Intronic
994239886 5:97407380-97407402 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
997610782 5:135214105-135214127 GGCTCCAGGACCCTGCCAGCAGG + Intronic
998755972 5:145379767-145379789 GGTCACAGGAGCCAACCTGCAGG + Intergenic
999133125 5:149299642-149299664 GCCGCCAGCAGCCTGCCTGGAGG + Intronic
999736523 5:154517382-154517404 GTGCCCAGGAGCCAGCCGGCTGG - Intergenic
999809587 5:155115021-155115043 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1000084763 5:157879500-157879522 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1000318863 5:160118598-160118620 GGCCCCAGGTGGGCGCCTGCGGG - Intronic
1000373476 5:160558722-160558744 ACCCCCATGAGCCTGCCTGGTGG - Intergenic
1001193779 5:169653641-169653663 GGCCACAGGAGGCTTCCTGCAGG - Intronic
1001252959 5:170162570-170162592 AGCCCCAGGAGGCTGGCTTCTGG - Intergenic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1005997117 6:30938291-30938313 GACCCCAGGAATCTACCTGCAGG - Intergenic
1006136133 6:31897376-31897398 GGCCCCAGGAGCACGCGTGAGGG - Intronic
1006378642 6:33685241-33685263 GGCTGCAGGGGCCTGGCTGCAGG - Intronic
1006636724 6:35466518-35466540 TAGCCCAGGAGCCTCCCTGCTGG - Exonic
1006983424 6:38162990-38163012 TGCCCCAGGGCCCTGCCTGGAGG - Intergenic
1006983436 6:38163019-38163041 TGCCCCAGGGCCCTGCCTGGAGG - Intergenic
1007476943 6:42125236-42125258 GGACCCTGGAGCCTGGCTTCAGG + Intronic
1008844854 6:55950529-55950551 GGCCTCAGCCGCCTCCCTGCGGG + Intergenic
1009307120 6:62103750-62103772 GGCAGCAGCAGCCTGCCTGGAGG - Intronic
1011774693 6:90716549-90716571 TGATCCAGGAGCCTTCCTGCAGG - Intergenic
1011970842 6:93220724-93220746 GGCCTCAGGGGCCTTCCTGAGGG + Intergenic
1012598877 6:101070482-101070504 GGCCTCAGCTGCCTCCCTGCAGG + Intergenic
1015803210 6:137081189-137081211 GTCCCCAGCATACTGCCTGCTGG - Intergenic
1017696545 6:157021527-157021549 GCCCCCACGAGCCTACGTGCGGG - Intronic
1018368889 6:163149585-163149607 GACCCCGCGAGCCTCCCTGCAGG + Intronic
1018474174 6:164123754-164123776 TGCTGCAGGAGCCTGCCTGGAGG - Intergenic
1018908582 6:168089096-168089118 GGGGCCAGCAGCCTGCCTGGGGG + Intergenic
1018987991 6:168652327-168652349 GGCCCCTGGATTCTGCCTGTTGG - Intronic
1019347740 7:538973-538995 GGTCCCAGGAGCCGGCCTGGAGG + Intergenic
1019433464 7:1010347-1010369 GGCACCTGGCGCCTGCCCGCAGG - Intronic
1019500332 7:1361309-1361331 GGCCCCAGGAGGGAGCCTGAGGG + Intergenic
1019516383 7:1442029-1442051 GACCCCAGGAGGCTGCGAGCAGG + Intronic
1019625346 7:2013084-2013106 GGCCCCTGGAGCCGAGCTGCTGG - Intronic
1019707549 7:2503764-2503786 GGGCCCAGCCTCCTGCCTGCAGG + Intergenic
1019715639 7:2538092-2538114 GGCCACGGGAGGCTTCCTGCAGG - Exonic
1019920954 7:4163112-4163134 GGCCTCAGGAACCTCCCTGTGGG - Intronic
1020662181 7:10995693-10995715 GGCCTCAGCTGCCTCCCTGCGGG - Intronic
1021065742 7:16170722-16170744 GGCCTCAGCTGCCTCCCTGCAGG - Intronic
1021573914 7:22090635-22090657 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1023232519 7:38049968-38049990 GGCCTCAGCTGCCTCCCTGCCGG + Intergenic
1024567020 7:50689518-50689540 GGAGCCAGGAGCCTGCCTTGTGG - Intronic
1029329949 7:99844573-99844595 AGCACCAGGAGGCTCCCTGCTGG + Intronic
1029382093 7:100221070-100221092 GGCCCCAGGGCCCTGCCGCCTGG + Exonic
1029466231 7:100726707-100726729 GCCCCCAGGAGGCTGCCCACTGG - Intergenic
1031416769 7:121504689-121504711 GGCATCAGGAGACTGCCTGGTGG - Intergenic
1031977925 7:128105486-128105508 GGCCCCAGGTGCCAGCCGGCAGG + Intergenic
1032431327 7:131864472-131864494 GAGCCCAGGAGGCTGCCTCCAGG - Intergenic
1033269367 7:139916826-139916848 GGCCACAGGGACCCGCCTGCTGG + Intronic
1035970208 8:4239430-4239452 GGCTCCAGGACCCAGCCTCCAGG - Intronic
1036222139 8:6929777-6929799 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036224412 8:6945493-6945515 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036229023 8:6983795-6983817 AGCACCAGGACCCTCCCTGCAGG - Intergenic
1036231476 8:7002900-7002922 AGCACCAGGACCCTCCCTGCAGG - Intronic
1036301572 8:7572731-7572753 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1036751880 8:11448807-11448829 GGCCCCAGAAGCCTGGTTTCTGG + Intronic
1036846406 8:12173497-12173519 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1036867769 8:12415816-12415838 GGGCCCTGGTGCCTGACTGCAGG + Intergenic
1036928628 8:12931446-12931468 GGCCTCAGCCGCCTCCCTGCGGG - Intergenic
1037417557 8:18667825-18667847 GGCCTCAGCTGCCTCCCTGCGGG - Intronic
1037822857 8:22143532-22143554 GGCCCCAGAAGGCAGCCAGCAGG - Intergenic
1038477074 8:27876044-27876066 GGCCACAGGAGCTAGCCTGCAGG + Intronic
1039237966 8:35523846-35523868 TGCCCCAGGAGACTGCCTGAAGG + Intronic
1039790031 8:40868362-40868384 AGCTCCAGGACTCTGCCTGCAGG + Intronic
1040003684 8:42600208-42600230 GGCCTCAGTCGCCTCCCTGCAGG - Intergenic
1040804357 8:51377735-51377757 GGCCTCAGCTGCCTCCCTGCGGG + Intronic
1040806821 8:51404967-51404989 GGCCTCAGCTGCCTCCCTGCGGG - Intronic
1041449825 8:57994745-57994767 GTCCCCCGGAGCCTGGCTCCCGG + Exonic
1042091323 8:65162716-65162738 TGCCTCTGGAGTCTGCCTGCGGG - Intergenic
1042723706 8:71849998-71850020 TTCCACAGGAGCCTGCATGCTGG - Intronic
1043656549 8:82674509-82674531 GGCCCTAGGGGCCGCCCTGCTGG - Intergenic
1043670656 8:82880907-82880929 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1043993970 8:86790115-86790137 AGACCCATGAACCTGCCTGCAGG - Intergenic
1046251900 8:111643045-111643067 GGCCTCAGCTGCCTCCCTGCGGG + Intergenic
1046743279 8:117850828-117850850 AGCCTCAGGACCCTGCCTGCAGG + Intronic
1048209474 8:132442968-132442990 GGCCTCAGGAGCCTGTCTCTGGG - Intronic
1049250823 8:141588141-141588163 GGCCCCAGAAGCTGTCCTGCTGG - Intergenic
1049461156 8:142728445-142728467 GGCCCCAGGTGCCATGCTGCAGG - Intronic
1049620642 8:143597051-143597073 GGCCCCAGCAGCCTGGCCGAGGG + Intronic
1049646902 8:143739606-143739628 GAGCCCAGGTGCCTTCCTGCGGG + Intergenic
1049671475 8:143872013-143872035 GGCAGCCGGAGCCTGCGTGCTGG + Exonic
1049753175 8:144295383-144295405 AGCCCCAGGAGCCACCCAGCTGG + Intronic
1049773652 8:144395038-144395060 GGCCTCAGGATGCTGCCTGGAGG + Intronic
1049807826 8:144548829-144548851 GGGCCCAGGAGCCTGCCCGGCGG - Intronic
1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG + Intronic
1052982326 9:34458333-34458355 GGCCCCAGGAGCCCGGCGGGTGG + Exonic
1053362762 9:37501044-37501066 GGCCCCAGGAGCCTTCCAAATGG - Intronic
1053415978 9:37946980-37947002 GGCCCCATCAGCATGCCTGGTGG + Intronic
1055497030 9:76866139-76866161 GGCCCCAGGATTGGGCCTGCTGG - Intronic
1055525153 9:77125823-77125845 GATCCCAGGAGGCTCCCTGCTGG - Intergenic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1058866642 9:109167153-109167175 GGCCCGAGCGGCCTGGCTGCGGG - Exonic
1058967096 9:110048633-110048655 GGCCCCAGGAGCAGGCGGGCGGG + Exonic
1058991244 9:110256622-110256644 CGCCCCTGGAGCCTGCGAGCCGG + Exonic
1059338006 9:113581074-113581096 GGCCCCAGGGAGCTGGCTGCAGG + Intronic
1059393937 9:114018570-114018592 TGGGCCTGGAGCCTGCCTGCCGG - Intronic
1060404877 9:123368242-123368264 GTGCCCAGGAGCCTGCCAGGGGG - Intronic
1061227010 9:129286223-129286245 TGCCTCCCGAGCCTGCCTGCCGG - Intergenic
1061761546 9:132855210-132855232 AGCCCCAAGTGCCAGCCTGCAGG + Intronic
1062045066 9:134421235-134421257 GCCTCCAGGAGCCAGCCGGCAGG - Intronic
1062218126 9:135400016-135400038 GGCCCCAGGTGCCTGCAGACAGG + Intergenic
1062354710 9:136156530-136156552 GGCTCCAGGAGCCCGCCGGGCGG + Intergenic
1062439810 9:136564607-136564629 GCCCCCAGGTCCCGGCCTGCAGG - Intergenic
1062460101 9:136659416-136659438 GGCCGCGGGAGCCGGGCTGCAGG - Exonic
1062469388 9:136695888-136695910 GGACCCGGGTGCCTGCCTGGGGG - Intergenic
1185735205 X:2490725-2490747 CTCCACCGGAGCCTGCCTGCTGG + Exonic
1185894093 X:3843246-3843268 GGCCCCGGGTGCCCGCCTCCTGG - Intronic
1185899211 X:3881670-3881692 GGCCCCGGGTGCCCGCCTCCTGG - Intergenic
1185904328 X:3920099-3920121 GGCCCCGGGTGCCCGCCTCCTGG - Intergenic
1189411926 X:40780110-40780132 GGCCCCAGGACTCTGCCTCATGG + Intergenic
1189929644 X:45995841-45995863 GTCCCCAAGAGCCTGCCTGGTGG + Intergenic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1192173612 X:68872327-68872349 GGGCCCTGCAGCCTGCCGGCTGG - Intergenic
1196858216 X:120003009-120003031 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1196860031 X:120017877-120017899 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1198531174 X:137550657-137550679 GGGCACAGGAGCCTGCGAGCTGG - Intergenic
1199677282 X:150199248-150199270 GGCTCCAGGCCCTTGCCTGCAGG - Intergenic
1199975668 X:152893620-152893642 TATCCCAGGAGCCTCCCTGCCGG + Intergenic
1200074368 X:153543907-153543929 GGCCCCAGGGCCCTGGCTGGAGG - Intronic
1200117907 X:153777181-153777203 GGGCACAGGAGCCTGGCTTCAGG - Intronic
1200239544 X:154486521-154486543 GGCCCGGGGACCCTACCTGCAGG + Exonic
1200398239 X:156003673-156003695 GCCGCCAGGAGCCTGGTTGCTGG - Exonic