ID: 1157596346

View in Genome Browser
Species Human (GRCh38)
Location 18:48866326-48866348
Sequence ATATACAAAGGGTGCTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157596346_1157596350 -5 Left 1157596346 18:48866326-48866348 CCATAGCAGCACCCTTTGTATAT No data
Right 1157596350 18:48866344-48866366 TATATGCCTAACAGGTGTATTGG No data
1157596346_1157596354 21 Left 1157596346 18:48866326-48866348 CCATAGCAGCACCCTTTGTATAT No data
Right 1157596354 18:48866370-48866392 TACCTGAGTGTCATCTGAGCTGG No data
1157596346_1157596355 22 Left 1157596346 18:48866326-48866348 CCATAGCAGCACCCTTTGTATAT No data
Right 1157596355 18:48866371-48866393 ACCTGAGTGTCATCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157596346 Original CRISPR ATATACAAAGGGTGCTGCTA TGG (reversed) Intergenic
No off target data available for this crispr