ID: 1157601600

View in Genome Browser
Species Human (GRCh38)
Location 18:48896624-48896646
Sequence GGGTCCTGGCCAACAAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601600_1157601609 -1 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601609 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data
1157601600_1157601613 18 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601613 18:48896665-48896687 TTGGCCTACCCACAGCTTCCAGG No data
1157601600_1157601604 -10 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data
1157601600_1157601615 24 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601600_1157601619 28 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601619 18:48896675-48896697 CACAGCTTCCAGGCAGAGGGAGG No data
1157601600_1157601616 25 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601616 18:48896672-48896694 ACCCACAGCTTCCAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601600 Original CRISPR GGGTCCTGGCCAACAAGATG AGG (reversed) Intergenic
No off target data available for this crispr