ID: 1157601604

View in Genome Browser
Species Human (GRCh38)
Location 18:48896637-48896659
Sequence GCCAGGACCCCCCTCCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601600_1157601604 -10 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data
1157601596_1157601604 11 Left 1157601596 18:48896603-48896625 CCTCACCTTGTAGCAGTCTTACC No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data
1157601594_1157601604 27 Left 1157601594 18:48896587-48896609 CCACTCCACTCTTCAGCCTCACC No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data
1157601595_1157601604 22 Left 1157601595 18:48896592-48896614 CCACTCTTCAGCCTCACCTTGTA No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data
1157601597_1157601604 6 Left 1157601597 18:48896608-48896630 CCTTGTAGCAGTCTTACCTCATC No data
Right 1157601604 18:48896637-48896659 GCCAGGACCCCCCTCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601604 Original CRISPR GCCAGGACCCCCCTCCTTGG GGG Intergenic
No off target data available for this crispr