ID: 1157601605

View in Genome Browser
Species Human (GRCh38)
Location 18:48896638-48896660
Sequence TCCCCCAAGGAGGGGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601605_1157601615 10 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601605_1157601622 30 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601605_1157601616 11 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601616 18:48896672-48896694 ACCCACAGCTTCCAGGCAGAGGG No data
1157601605_1157601619 14 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601619 18:48896675-48896697 CACAGCTTCCAGGCAGAGGGAGG No data
1157601605_1157601613 4 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601613 18:48896665-48896687 TTGGCCTACCCACAGCTTCCAGG No data
1157601605_1157601621 29 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601621 18:48896690-48896712 GAGGGAGGACTGTCTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601605 Original CRISPR TCCCCCAAGGAGGGGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr