ID: 1157601609

View in Genome Browser
Species Human (GRCh38)
Location 18:48896646-48896668
Sequence CCCCTCCTTGGGGGAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601600_1157601609 -1 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601609 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data
1157601596_1157601609 20 Left 1157601596 18:48896603-48896625 CCTCACCTTGTAGCAGTCTTACC No data
Right 1157601609 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data
1157601597_1157601609 15 Left 1157601597 18:48896608-48896630 CCTTGTAGCAGTCTTACCTCATC No data
Right 1157601609 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601609 Original CRISPR CCCCTCCTTGGGGGAGCTGT TGG Intergenic
No off target data available for this crispr