ID: 1157601615

View in Genome Browser
Species Human (GRCh38)
Location 18:48896671-48896693
Sequence TACCCACAGCTTCCAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601610_1157601615 1 Left 1157601610 18:48896647-48896669 CCCTCCTTGGGGGAGCTGTTGGC No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601605_1157601615 10 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601612_1157601615 -3 Left 1157601612 18:48896651-48896673 CCTTGGGGGAGCTGTTGGCCTAC No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601608_1157601615 2 Left 1157601608 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601606_1157601615 4 Left 1157601606 18:48896644-48896666 CCCCCCTCCTTGGGGGAGCTGTT No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601600_1157601615 24 Left 1157601600 18:48896624-48896646 CCTCATCTTGTTGGCCAGGACCC No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601607_1157601615 3 Left 1157601607 18:48896645-48896667 CCCCCTCCTTGGGGGAGCTGTTG No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data
1157601611_1157601615 0 Left 1157601611 18:48896648-48896670 CCTCCTTGGGGGAGCTGTTGGCC No data
Right 1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601615 Original CRISPR TACCCACAGCTTCCAGGCAG AGG Intergenic
No off target data available for this crispr