ID: 1157601622

View in Genome Browser
Species Human (GRCh38)
Location 18:48896691-48896713
Sequence AGGGAGGACTGTCTCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601614_1157601622 -1 Left 1157601614 18:48896669-48896691 CCTACCCACAGCTTCCAGGCAGA No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601618_1157601622 -6 Left 1157601618 18:48896674-48896696 CCACAGCTTCCAGGCAGAGGGAG No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601612_1157601622 17 Left 1157601612 18:48896651-48896673 CCTTGGGGGAGCTGTTGGCCTAC No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601605_1157601622 30 Left 1157601605 18:48896638-48896660 CCAGGACCCCCCTCCTTGGGGGA No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601611_1157601622 20 Left 1157601611 18:48896648-48896670 CCTCCTTGGGGGAGCTGTTGGCC No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601610_1157601622 21 Left 1157601610 18:48896647-48896669 CCCTCCTTGGGGGAGCTGTTGGC No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601606_1157601622 24 Left 1157601606 18:48896644-48896666 CCCCCCTCCTTGGGGGAGCTGTT No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601617_1157601622 -5 Left 1157601617 18:48896673-48896695 CCCACAGCTTCCAGGCAGAGGGA No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601608_1157601622 22 Left 1157601608 18:48896646-48896668 CCCCTCCTTGGGGGAGCTGTTGG No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data
1157601607_1157601622 23 Left 1157601607 18:48896645-48896667 CCCCCTCCTTGGGGGAGCTGTTG No data
Right 1157601622 18:48896691-48896713 AGGGAGGACTGTCTCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601622 Original CRISPR AGGGAGGACTGTCTCCCTCA GGG Intergenic
No off target data available for this crispr