ID: 1157601623

View in Genome Browser
Species Human (GRCh38)
Location 18:48896702-48896724
Sequence TCTCCCTCAGGGCCTTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157601612_1157601623 28 Left 1157601612 18:48896651-48896673 CCTTGGGGGAGCTGTTGGCCTAC No data
Right 1157601623 18:48896702-48896724 TCTCCCTCAGGGCCTTGATGAGG No data
1157601617_1157601623 6 Left 1157601617 18:48896673-48896695 CCCACAGCTTCCAGGCAGAGGGA No data
Right 1157601623 18:48896702-48896724 TCTCCCTCAGGGCCTTGATGAGG No data
1157601620_1157601623 -4 Left 1157601620 18:48896683-48896705 CCAGGCAGAGGGAGGACTGTCTC No data
Right 1157601623 18:48896702-48896724 TCTCCCTCAGGGCCTTGATGAGG No data
1157601614_1157601623 10 Left 1157601614 18:48896669-48896691 CCTACCCACAGCTTCCAGGCAGA No data
Right 1157601623 18:48896702-48896724 TCTCCCTCAGGGCCTTGATGAGG No data
1157601618_1157601623 5 Left 1157601618 18:48896674-48896696 CCACAGCTTCCAGGCAGAGGGAG No data
Right 1157601623 18:48896702-48896724 TCTCCCTCAGGGCCTTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157601623 Original CRISPR TCTCCCTCAGGGCCTTGATG AGG Intergenic
No off target data available for this crispr