ID: 1157617888

View in Genome Browser
Species Human (GRCh38)
Location 18:48998198-48998220
Sequence CTGAGAGGGGACGTGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157617877_1157617888 11 Left 1157617877 18:48998164-48998186 CCTAAAATAGCTTGGTCCTGTTT No data
Right 1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG No data
1157617881_1157617888 -5 Left 1157617881 18:48998180-48998202 CCTGTTTATGGGGCTGCTCTGAG No data
Right 1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG No data
1157617875_1157617888 13 Left 1157617875 18:48998162-48998184 CCCCTAAAATAGCTTGGTCCTGT No data
Right 1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG No data
1157617873_1157617888 30 Left 1157617873 18:48998145-48998167 CCACATTTGATCTTCTTCCCCTA No data
Right 1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG No data
1157617876_1157617888 12 Left 1157617876 18:48998163-48998185 CCCTAAAATAGCTTGGTCCTGTT No data
Right 1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157617888 Original CRISPR CTGAGAGGGGACGTGGGCGT GGG Intergenic
No off target data available for this crispr