ID: 1157618291

View in Genome Browser
Species Human (GRCh38)
Location 18:49000953-49000975
Sequence GACTAATGAGCCTGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157618291_1157618295 2 Left 1157618291 18:49000953-49000975 CCACCGTGCCAGGCTCATTAGTC No data
Right 1157618295 18:49000978-49001000 TTTTTGATGGAAAAGTATCCTGG No data
1157618291_1157618296 12 Left 1157618291 18:49000953-49000975 CCACCGTGCCAGGCTCATTAGTC No data
Right 1157618296 18:49000988-49001010 AAAAGTATCCTGGAAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157618291 Original CRISPR GACTAATGAGCCTGGCACGG TGG (reversed) Intergenic
No off target data available for this crispr