ID: 1157618606

View in Genome Browser
Species Human (GRCh38)
Location 18:49002438-49002460
Sequence CAGCAGAAACAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157618606_1157618612 -3 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618612 18:49002458-49002480 CTGTCAGCATGGACCCTGGAGGG No data
1157618606_1157618618 30 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618618 18:49002491-49002513 GCCTGGGACGGCTGTGACTCCGG No data
1157618606_1157618611 -4 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618611 18:49002457-49002479 GCTGTCAGCATGGACCCTGGAGG No data
1157618606_1157618617 18 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618617 18:49002479-49002501 GGCACACAGCAAGCCTGGGACGG No data
1157618606_1157618610 -7 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618610 18:49002454-49002476 TCTGCTGTCAGCATGGACCCTGG No data
1157618606_1157618616 14 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618616 18:49002475-49002497 GGAGGGCACACAGCAAGCCTGGG No data
1157618606_1157618615 13 Left 1157618606 18:49002438-49002460 CCCTGCTGCCTCTGTTTCTGCTG No data
Right 1157618615 18:49002474-49002496 TGGAGGGCACACAGCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157618606 Original CRISPR CAGCAGAAACAGAGGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr