ID: 1157619382

View in Genome Browser
Species Human (GRCh38)
Location 18:49007333-49007355
Sequence GGTTCTGCAAACTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157619382_1157619387 -8 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619387 18:49007348-49007370 GCAGAACCTTCCTGGGCTTGGGG No data
1157619382_1157619392 8 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619392 18:49007364-49007386 CTTGGGGCTCAGGCTGACCCGGG No data
1157619382_1157619386 -9 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619386 18:49007347-49007369 TGCAGAACCTTCCTGGGCTTGGG No data
1157619382_1157619389 -2 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619389 18:49007354-49007376 CCTTCCTGGGCTTGGGGCTCAGG No data
1157619382_1157619391 7 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619391 18:49007363-49007385 GCTTGGGGCTCAGGCTGACCCGG No data
1157619382_1157619385 -10 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619385 18:49007346-49007368 TTGCAGAACCTTCCTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157619382 Original CRISPR GGTTCTGCAAACTCCACTGC AGG (reversed) Intergenic
No off target data available for this crispr