ID: 1157619386

View in Genome Browser
Species Human (GRCh38)
Location 18:49007347-49007369
Sequence TGCAGAACCTTCCTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157619382_1157619386 -9 Left 1157619382 18:49007333-49007355 CCTGCAGTGGAGTTTGCAGAACC No data
Right 1157619386 18:49007347-49007369 TGCAGAACCTTCCTGGGCTTGGG No data
1157619380_1157619386 4 Left 1157619380 18:49007320-49007342 CCGAGACATGATTCCTGCAGTGG No data
Right 1157619386 18:49007347-49007369 TGCAGAACCTTCCTGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157619386 Original CRISPR TGCAGAACCTTCCTGGGCTT GGG Intergenic