ID: 1157619628

View in Genome Browser
Species Human (GRCh38)
Location 18:49008847-49008869
Sequence CCCACCACTGTGCCAGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157619628_1157619643 22 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619643 18:49008892-49008914 CGTGGGGAAGGAGGGCTGGAGGG No data
1157619628_1157619639 14 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619639 18:49008884-49008906 TCAGGCCTCGTGGGGAAGGAGGG No data
1157619628_1157619632 -10 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619632 18:49008860-49008882 CAGTGGTGGGTTTCAGCAGGAGG No data
1157619628_1157619638 13 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619638 18:49008883-49008905 CTCAGGCCTCGTGGGGAAGGAGG No data
1157619628_1157619634 4 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619634 18:49008874-49008896 AGCAGGAGGCTCAGGCCTCGTGG No data
1157619628_1157619642 21 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG No data
1157619628_1157619640 18 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619640 18:49008888-49008910 GCCTCGTGGGGAAGGAGGGCTGG No data
1157619628_1157619636 6 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619636 18:49008876-49008898 CAGGAGGCTCAGGCCTCGTGGGG No data
1157619628_1157619637 10 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619637 18:49008880-49008902 AGGCTCAGGCCTCGTGGGGAAGG No data
1157619628_1157619633 -4 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619633 18:49008866-49008888 TGGGTTTCAGCAGGAGGCTCAGG No data
1157619628_1157619635 5 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619635 18:49008875-49008897 GCAGGAGGCTCAGGCCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157619628 Original CRISPR CCCACCACTGTGCCAGGCCT AGG (reversed) Intergenic
No off target data available for this crispr