ID: 1157619630

View in Genome Browser
Species Human (GRCh38)
Location 18:49008853-49008875
Sequence CTGAAACCCACCACTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157619630_1157619643 16 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619643 18:49008892-49008914 CGTGGGGAAGGAGGGCTGGAGGG No data
1157619630_1157619633 -10 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619633 18:49008866-49008888 TGGGTTTCAGCAGGAGGCTCAGG No data
1157619630_1157619640 12 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619640 18:49008888-49008910 GCCTCGTGGGGAAGGAGGGCTGG No data
1157619630_1157619637 4 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619637 18:49008880-49008902 AGGCTCAGGCCTCGTGGGGAAGG No data
1157619630_1157619644 30 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619644 18:49008906-49008928 GCTGGAGGGAGCCATCTCAGAGG No data
1157619630_1157619642 15 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG No data
1157619630_1157619638 7 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619638 18:49008883-49008905 CTCAGGCCTCGTGGGGAAGGAGG No data
1157619630_1157619635 -1 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619635 18:49008875-49008897 GCAGGAGGCTCAGGCCTCGTGGG No data
1157619630_1157619636 0 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619636 18:49008876-49008898 CAGGAGGCTCAGGCCTCGTGGGG No data
1157619630_1157619634 -2 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619634 18:49008874-49008896 AGCAGGAGGCTCAGGCCTCGTGG No data
1157619630_1157619639 8 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619639 18:49008884-49008906 TCAGGCCTCGTGGGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157619630 Original CRISPR CTGAAACCCACCACTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr