ID: 1157619642

View in Genome Browser
Species Human (GRCh38)
Location 18:49008891-49008913
Sequence TCGTGGGGAAGGAGGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157619630_1157619642 15 Left 1157619630 18:49008853-49008875 CCTGGCACAGTGGTGGGTTTCAG No data
Right 1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG No data
1157619625_1157619642 27 Left 1157619625 18:49008841-49008863 CCGAGGCCTAGGCCTGGCACAGT No data
Right 1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG No data
1157619628_1157619642 21 Left 1157619628 18:49008847-49008869 CCTAGGCCTGGCACAGTGGTGGG No data
Right 1157619642 18:49008891-49008913 TCGTGGGGAAGGAGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157619642 Original CRISPR TCGTGGGGAAGGAGGGCTGG AGG Intergenic
No off target data available for this crispr