ID: 1157622383

View in Genome Browser
Species Human (GRCh38)
Location 18:49024000-49024022
Sequence CGCAGGAGGTTCGGGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157622383_1157622397 18 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622383_1157622398 19 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622383_1157622388 -10 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622388 18:49024013-49024035 ACCTCCTGCGGCCCTTGTCCTGG No data
1157622383_1157622396 17 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622396 18:49024040-49024062 CTGGTCTACTGAGCCGCCTCTGG No data
1157622383_1157622391 -2 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157622383 Original CRISPR CGCAGGAGGTTCGGGAGGAG AGG (reversed) Intergenic
No off target data available for this crispr