ID: 1157622391

View in Genome Browser
Species Human (GRCh38)
Location 18:49024021-49024043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157622378_1157622391 14 Left 1157622378 18:49023984-49024006 CCCTGGCCCTGGCCTGCCTCTCC No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622376_1157622391 23 Left 1157622376 18:49023975-49023997 CCCAAAGCACCCTGGCCCTGGCC No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622381_1157622391 7 Left 1157622381 18:49023991-49024013 CCTGGCCTGCCTCTCCTCCCGAA No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622382_1157622391 2 Left 1157622382 18:49023996-49024018 CCTGCCTCTCCTCCCGAACCTCC No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622377_1157622391 22 Left 1157622377 18:49023976-49023998 CCAAAGCACCCTGGCCCTGGCCT No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622383_1157622391 -2 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622385_1157622391 -7 Left 1157622385 18:49024005-49024027 CCTCCCGAACCTCCTGCGGCCCT No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622379_1157622391 13 Left 1157622379 18:49023985-49024007 CCTGGCCCTGGCCTGCCTCTCCT No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622380_1157622391 8 Left 1157622380 18:49023990-49024012 CCCTGGCCTGCCTCTCCTCCCGA No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data
1157622386_1157622391 -10 Left 1157622386 18:49024008-49024030 CCCGAACCTCCTGCGGCCCTTGT No data
Right 1157622391 18:49024021-49024043 CGGCCCTTGTCCTGGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157622391 Original CRISPR CGGCCCTTGTCCTGGTCACC TGG Intergenic
No off target data available for this crispr