ID: 1157622397

View in Genome Browser
Species Human (GRCh38)
Location 18:49024041-49024063
Sequence TGGTCTACTGAGCCGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157622389_1157622397 4 Left 1157622389 18:49024014-49024036 CCTCCTGCGGCCCTTGTCCTGGT No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622392_1157622397 -6 Left 1157622392 18:49024024-49024046 CCCTTGTCCTGGTCACCTGGTCT No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622393_1157622397 -7 Left 1157622393 18:49024025-49024047 CCTTGTCCTGGTCACCTGGTCTA No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622387_1157622397 9 Left 1157622387 18:49024009-49024031 CCGAACCTCCTGCGGCCCTTGTC No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622381_1157622397 27 Left 1157622381 18:49023991-49024013 CCTGGCCTGCCTCTCCTCCCGAA No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622382_1157622397 22 Left 1157622382 18:49023996-49024018 CCTGCCTCTCCTCCCGAACCTCC No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622386_1157622397 10 Left 1157622386 18:49024008-49024030 CCCGAACCTCCTGCGGCCCTTGT No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622383_1157622397 18 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622380_1157622397 28 Left 1157622380 18:49023990-49024012 CCCTGGCCTGCCTCTCCTCCCGA No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622385_1157622397 13 Left 1157622385 18:49024005-49024027 CCTCCCGAACCTCCTGCGGCCCT No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data
1157622390_1157622397 1 Left 1157622390 18:49024017-49024039 CCTGCGGCCCTTGTCCTGGTCAC No data
Right 1157622397 18:49024041-49024063 TGGTCTACTGAGCCGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157622397 Original CRISPR TGGTCTACTGAGCCGCCTCT GGG Intergenic
No off target data available for this crispr