ID: 1157622398

View in Genome Browser
Species Human (GRCh38)
Location 18:49024042-49024064
Sequence GGTCTACTGAGCCGCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157622380_1157622398 29 Left 1157622380 18:49023990-49024012 CCCTGGCCTGCCTCTCCTCCCGA No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622389_1157622398 5 Left 1157622389 18:49024014-49024036 CCTCCTGCGGCCCTTGTCCTGGT No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622381_1157622398 28 Left 1157622381 18:49023991-49024013 CCTGGCCTGCCTCTCCTCCCGAA No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622387_1157622398 10 Left 1157622387 18:49024009-49024031 CCGAACCTCCTGCGGCCCTTGTC No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622393_1157622398 -6 Left 1157622393 18:49024025-49024047 CCTTGTCCTGGTCACCTGGTCTA No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622383_1157622398 19 Left 1157622383 18:49024000-49024022 CCTCTCCTCCCGAACCTCCTGCG No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622385_1157622398 14 Left 1157622385 18:49024005-49024027 CCTCCCGAACCTCCTGCGGCCCT No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622390_1157622398 2 Left 1157622390 18:49024017-49024039 CCTGCGGCCCTTGTCCTGGTCAC No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622382_1157622398 23 Left 1157622382 18:49023996-49024018 CCTGCCTCTCCTCCCGAACCTCC No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622392_1157622398 -5 Left 1157622392 18:49024024-49024046 CCCTTGTCCTGGTCACCTGGTCT No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data
1157622386_1157622398 11 Left 1157622386 18:49024008-49024030 CCCGAACCTCCTGCGGCCCTTGT No data
Right 1157622398 18:49024042-49024064 GGTCTACTGAGCCGCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157622398 Original CRISPR GGTCTACTGAGCCGCCTCTG GGG Intergenic
No off target data available for this crispr