ID: 1157622921

View in Genome Browser
Species Human (GRCh38)
Location 18:49026562-49026584
Sequence CAGTGACAGCCCAGGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157622917_1157622921 13 Left 1157622917 18:49026526-49026548 CCAGGTACAGATGGGGAAACTGA No data
Right 1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157622921 Original CRISPR CAGTGACAGCCCAGGCACAC AGG Intergenic
No off target data available for this crispr