ID: 1157623741

View in Genome Browser
Species Human (GRCh38)
Location 18:49031468-49031490
Sequence CCATCCACATAGTGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157623732_1157623741 27 Left 1157623732 18:49031418-49031440 CCACTCTATCAGCTGCAATAGCA No data
Right 1157623741 18:49031468-49031490 CCATCCACATAGTGGGAGCTGGG No data
1157623731_1157623741 28 Left 1157623731 18:49031417-49031439 CCCACTCTATCAGCTGCAATAGC No data
Right 1157623741 18:49031468-49031490 CCATCCACATAGTGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157623741 Original CRISPR CCATCCACATAGTGGGAGCT GGG Intergenic
No off target data available for this crispr