ID: 1157624062

View in Genome Browser
Species Human (GRCh38)
Location 18:49034333-49034355
Sequence CATTAGATTCATAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157624062_1157624068 2 Left 1157624062 18:49034333-49034355 CCTTCCAACTTATGAATCTAATG No data
Right 1157624068 18:49034358-49034380 CCTGGAGTGGTCCCTTATTTAGG No data
1157624062_1157624069 3 Left 1157624062 18:49034333-49034355 CCTTCCAACTTATGAATCTAATG No data
Right 1157624069 18:49034359-49034381 CTGGAGTGGTCCCTTATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157624062 Original CRISPR CATTAGATTCATAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr