ID: 1157630223

View in Genome Browser
Species Human (GRCh38)
Location 18:49087941-49087963
Sequence CCTGTGCCTGCTTTTTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17534
Summary {0: 1, 1: 25, 2: 331, 3: 7048, 4: 10129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157630223 Original CRISPR CCTGTGCCTGCTTTTTGATG GGG Intronic
Too many off-targets to display for this crispr