ID: 1157635825

View in Genome Browser
Species Human (GRCh38)
Location 18:49153438-49153460
Sequence TCCAGGAGGATCATGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157635825_1157635831 0 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635831 18:49153461-49153483 GAAATGGTTGATTCCAGGGCTGG 0: 6
1: 48
2: 177
3: 423
4: 853
1157635825_1157635832 1 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635832 18:49153462-49153484 AAATGGTTGATTCCAGGGCTGGG 0: 8
1: 57
2: 199
3: 437
4: 1031
1157635825_1157635829 -5 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635829 18:49153456-49153478 CTGGAGAAATGGTTGATTCCAGG 0: 1
1: 24
2: 161
3: 510
4: 5078
1157635825_1157635833 2 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635833 18:49153463-49153485 AATGGTTGATTCCAGGGCTGGGG 0: 4
1: 41
2: 160
3: 385
4: 926
1157635825_1157635830 -4 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635830 18:49153457-49153479 TGGAGAAATGGTTGATTCCAGGG 0: 12
1: 70
2: 178
3: 331
4: 695
1157635825_1157635835 26 Left 1157635825 18:49153438-49153460 CCAAATTTCATGATCCTCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1157635835 18:49153487-49153509 AGAGAAAATACCCGATGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157635825 Original CRISPR TCCAGGAGGATCATGAAATT TGG (reversed) Intronic
900688102 1:3962001-3962023 TGCAGGAGGCTCTGGAAATTAGG + Intergenic
900744569 1:4352294-4352316 GGCAGGCGGATCATGAGATTGGG + Intergenic
900929837 1:5729517-5729539 TCCATGAGGACCATGAAACTTGG + Intergenic
902303729 1:15521437-15521459 TACGGGAGGAACATGAAAGTGGG - Intronic
905144631 1:35878312-35878334 GCCGGGAGGATCATGAGATCAGG - Intronic
905941543 1:41867207-41867229 TCCAGGAGTGGCATGAAATGAGG + Intronic
906351781 1:45067014-45067036 TACAGGAGGATAAATAAATTTGG + Intronic
906441363 1:45848638-45848660 TCCTGGAGGATCATGGAACCTGG + Intronic
914895116 1:151663377-151663399 TGCAGGAGGATCATGAGGTCAGG - Intronic
914950623 1:152110628-152110650 TCCAGGAGGATCAGGAGAGGAGG - Exonic
915750354 1:158203615-158203637 TCCAGGAGGCTAGAGAAATTAGG + Intergenic
918335980 1:183513597-183513619 GGCAGGAGGATCATGAAGTCAGG - Intronic
918558664 1:185837717-185837739 TCCAGGTTTATCATGACATTGGG - Intronic
919013236 1:191992597-191992619 TCCAGGAGAACCCTCAAATTGGG - Intergenic
919334235 1:196211521-196211543 TCAATGAGGATCCTGAAGTTTGG + Intergenic
923779994 1:237013704-237013726 TTCTGGAAGAACATGAAATTGGG - Intergenic
924057295 1:240136763-240136785 GCCAGGAGGAGTATAAAATTGGG + Intronic
924861853 1:247933372-247933394 GCAAGGAGGACCAGGAAATTAGG + Intergenic
1063013570 10:2051033-2051055 TCCAGGATGAACATATAATTTGG - Intergenic
1068559864 10:58502133-58502155 TCAAGGAGGATAAAGAAATAGGG - Intergenic
1072512088 10:96137807-96137829 GCTAGGTGGATGATGAAATTTGG - Intronic
1073673638 10:105620145-105620167 TCCAGGAGGACTCGGAAATTTGG - Intergenic
1074482214 10:113834429-113834451 GGCAGGCGGATCATGAAGTTGGG + Intergenic
1075205541 10:120444713-120444735 GGCAGGCGGATCATGAGATTAGG + Intergenic
1076440219 10:130476426-130476448 CCCAGGAGGATCATCAAAAAGGG - Intergenic
1078778879 11:14418610-14418632 GGCAGGAGGATCATGAAGTCAGG - Intergenic
1079486441 11:20940476-20940498 GGCAGGTGGATCATGAGATTAGG - Intronic
1080089740 11:28332525-28332547 TCCAGGAAGTACATGAATTTTGG - Exonic
1080786903 11:35483616-35483638 TCCAGGATGAGCAAGAGATTCGG - Intronic
1080872017 11:36244651-36244673 TCTAGGAGGAAAATGAAATGAGG - Intergenic
1082851040 11:57765045-57765067 TCCAGGAAGTTTAAGAAATTAGG - Intronic
1084318751 11:68361405-68361427 GGCAGGTGGATCATGAAGTTAGG + Intronic
1085500832 11:77021901-77021923 TCCTGGAGGTTCATAAAAATAGG - Exonic
1085926150 11:81024302-81024324 TCCAGGATGATAAAGGAATTAGG + Intergenic
1086200980 11:84202044-84202066 GGCAGGAGGATCATGAAGTCAGG - Intronic
1086345247 11:85889699-85889721 TCCAGGAAAATCATGAAAGAAGG - Intronic
1086605203 11:88687243-88687265 GGCAGGAGGATCATGAAGTCAGG + Intronic
1086615738 11:88816309-88816331 GGCAGGTGGATCATGAGATTAGG + Intronic
1087310671 11:96538493-96538515 AGCAGGAGGAGAATGAAATTAGG - Intergenic
1087558817 11:99757649-99757671 TCCAGGAAGAACATGAATTTTGG + Intronic
1087834339 11:102856886-102856908 TCCAGGAGCATCAATAAATCAGG - Intergenic
1089285179 11:117402446-117402468 GCCAGGAGGATCATGAGGTCAGG - Intronic
1089513642 11:119017785-119017807 CCCATTAGGATCATGAAAATGGG - Intronic
1092977134 12:13756241-13756263 GGCAGGTGGATCATGAAGTTAGG - Intronic
1094239698 12:28208157-28208179 TTCAGGAGGTTCATGAAAGATGG - Intronic
1096538768 12:52291455-52291477 TCCAGGAGGATCATGACCTGCGG - Exonic
1097982382 12:65747519-65747541 GGCAGGAGGAACATGGAATTAGG + Intergenic
1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG + Intergenic
1101953551 12:109194799-109194821 TCCAGGAAGGCCATGAATTTTGG + Intronic
1102406612 12:112679380-112679402 GGCAGGAGGATCATGAAGTCAGG - Intronic
1102987234 12:117288218-117288240 TCCTGGAAGATCAAGAGATTTGG + Exonic
1103577138 12:121886335-121886357 GCCAGGTGGATCATGAGGTTAGG - Intergenic
1106503688 13:30353350-30353372 TCCAGGAGGACGCTGAAATCTGG + Intergenic
1107046864 13:36002000-36002022 TTTAGGAGGATGATGAAGTTGGG + Intronic
1107582025 13:41800557-41800579 GGCAGGAGGATCATGAAGTCAGG + Intronic
1110657651 13:78019374-78019396 TCTAGGATGATAATGAAAGTTGG + Intergenic
1114084636 14:19230529-19230551 GGCAGGAGGATCATGAAATCAGG - Intergenic
1115500286 14:34043519-34043541 GGCAGGAGGATCATGAGATCAGG - Intronic
1117377974 14:55132794-55132816 GGCAGGAGGATCATGAGGTTAGG - Intronic
1118503572 14:66386845-66386867 TGCAGGTGGATCATGAAGTCAGG + Intergenic
1119411556 14:74434588-74434610 TCCAGAAGGGTCAGGAAACTGGG + Intergenic
1119828774 14:77682041-77682063 TCCTGGCGAATCATCAAATTTGG + Intronic
1119993301 14:79224607-79224629 TCCAGGAAGGACATGAATTTTGG - Intronic
1122568856 14:102679705-102679727 GGCAGGAGGATCATGAAGTCAGG - Intronic
1202896230 14_GL000194v1_random:12340-12362 GGCAGGAGGATCATGAAATCAGG - Intergenic
1125282848 15:38061355-38061377 TCCATAAGGATCATTAAATAAGG + Intergenic
1126861664 15:52890238-52890260 TCCAGGAGGAAAATGATATGTGG - Intergenic
1127857700 15:62966356-62966378 TTCAGGAGGATCAGAAAAGTAGG - Intergenic
1130007113 15:80110240-80110262 ACCAGGAGGCTCAGGGAATTGGG + Intronic
1130310480 15:82749542-82749564 TCCAGGAAGGACATGAATTTTGG - Intergenic
1133515545 16:6505433-6505455 TCCAGGAGGAATGTGAATTTTGG + Intronic
1135875858 16:26199447-26199469 TTCAGCAGGATCATTAAAATGGG + Intergenic
1137268321 16:46885986-46886008 TTCAGGGGGATCATGACACTTGG + Intronic
1137312111 16:47273193-47273215 TCTAGGCTGATAATGAAATTGGG - Intronic
1138207412 16:55134975-55134997 TCCAGCATGACTATGAAATTGGG - Intergenic
1138886656 16:61088198-61088220 TCCTGGAGGATGAAGTAATTTGG + Intergenic
1139268065 16:65658148-65658170 TGCAGGAGGATCATGAGGTCAGG - Intergenic
1141863879 16:86736444-86736466 TCCAGTAGGATCATGGTGTTGGG - Intergenic
1143798073 17:9354547-9354569 GGCAGGCGGATCATGAGATTAGG - Intronic
1149782894 17:59412079-59412101 GGCAGGTGGATCATGAAGTTGGG + Intergenic
1151778475 17:76226012-76226034 TCCAGGAGGATCGTAAGGTTTGG + Intronic
1155510102 18:26567714-26567736 GGCAGGCGGATCATGAAGTTAGG - Intronic
1157387635 18:47271687-47271709 TTCAGGAGGATAATAATATTAGG - Intergenic
1157635825 18:49153438-49153460 TCCAGGAGGATCATGAAATTTGG - Intronic
1157790652 18:50528226-50528248 TGAAGGAGGAGCAGGAAATTGGG + Intergenic
1158618656 18:59011104-59011126 GGCAGGTGGATCATGAAATCAGG + Intergenic
1165961062 19:39534619-39534641 CCCAGGAGGAGCCTGCAATTCGG + Intergenic
1167144782 19:47675261-47675283 TCCAGATGGAACAAGAAATTAGG + Intronic
1167480346 19:49726627-49726649 GGCAGGTGGATCATGAAATCAGG + Intergenic
1168673336 19:58258130-58258152 TCCATTAGGAGCATGAAATGAGG - Intronic
925713183 2:6761389-6761411 GTAAGGAGGATCCTGAAATTGGG - Intergenic
928023411 2:27721298-27721320 TCCAGTAGGCACATGAAAATAGG + Intergenic
928321710 2:30288910-30288932 TCCAGGAGAAGCAATAAATTGGG + Intronic
928641904 2:33307919-33307941 TCTAGGAGAAAAATGAAATTCGG + Intronic
932950818 2:76290890-76290912 TCCTGCAGGACCATGAAGTTAGG + Intergenic
933989029 2:87620226-87620248 TCTAGGATGATCATGACCTTTGG - Intergenic
935622141 2:105139562-105139584 TCCAGGAGCATAATAAAATATGG - Intergenic
936304814 2:111330600-111330622 TCTAGGATGATCATGACCTTTGG + Intergenic
937722118 2:125112795-125112817 TCCAGTAAGATCATGAGATCAGG + Intergenic
938491979 2:131765838-131765860 GGCAGGAGGATCATGAAATCAGG + Intronic
938495588 2:131796504-131796526 GGCAGGAAGATCATGAAATCAGG - Intronic
938906354 2:135840057-135840079 TCCTGGAAGACCATAAAATTTGG + Exonic
939049911 2:137295701-137295723 GGCAGGAGGATCATGAGATCAGG - Intronic
941919788 2:170839011-170839033 CCCTGGAAGATCATGAAATGTGG + Intronic
942906404 2:181185959-181185981 TTCAGGAGGAGCTTGGAATTAGG - Intergenic
943575201 2:189624217-189624239 TCCAGTAGGATAATTATATTCGG + Intergenic
944632188 2:201638727-201638749 TCCAGGAATATCATGGAAATAGG + Intronic
945014359 2:205499432-205499454 TCCATGAGGCTCATGAACTTTGG - Intronic
946891601 2:224282655-224282677 TCCAGGAGGAGAATGAAAAGGGG + Intergenic
1169327702 20:4688350-4688372 AAAAGGAGGATCAGGAAATTAGG - Intronic
1172827516 20:37803003-37803025 CCCAGGAAGATCAAGAAAGTGGG + Exonic
1173047661 20:39528160-39528182 CCCAGGAGGATCATGAGGGTTGG + Intergenic
1174097440 20:48100474-48100496 TCCAGCAGGATCCTGAAATTGGG - Intergenic
1175455366 20:59108662-59108684 TCCAGGAAGAACATGAATTTTGG + Intergenic
1176615910 21:9028336-9028358 GGCAGGAGGATCATGAAATCAGG - Intergenic
1176709240 21:10135392-10135414 GGCAGGAGGATCATGAAACCAGG + Intergenic
1177279402 21:18961339-18961361 TCAAGAAGGATCCTGAAATAGGG - Intergenic
1178360306 21:31943899-31943921 TCCAGGACTCTGATGAAATTGGG + Intronic
1178884424 21:36474096-36474118 TCCAGGGGAATCAGGAAATGAGG + Intronic
1179393578 21:41016395-41016417 TCCAACAGGATCATTGAATTAGG + Intergenic
1180293335 22:10862664-10862686 GGCAGGAGGATCATGAAATCAGG + Intergenic
1180496139 22:15892086-15892108 GGCAGGAGGATCATGAAATCAGG + Intergenic
1182640233 22:31761208-31761230 GGCAGGAGGATCATGAAGTCAGG - Intronic
1183713890 22:39522319-39522341 TCCAGGAGGATCGTAAGGTTTGG - Exonic
1184015895 22:41785489-41785511 GGCGGGAGGATCATGAAATCAGG - Intronic
949839077 3:8300879-8300901 TTCATCAGGATCAGGAAATTTGG + Intergenic
950421633 3:12903077-12903099 TCCAGGAGGAGTACAAAATTGGG - Intronic
952210786 3:31227183-31227205 TCCAGAAGGATCGTGAGATTAGG + Intergenic
953262648 3:41354674-41354696 TCCTGGAAGATCAGGAAATGAGG + Intronic
953865413 3:46579301-46579323 CCCAGGAGGAGCCTGCAATTCGG + Exonic
956529733 3:70204591-70204613 TCCATGAAGATAATTAAATTAGG - Intergenic
957035260 3:75288503-75288525 TCCTGGAGGGTCATGCATTTAGG + Intergenic
958448827 3:94247938-94247960 TCCAAAAGGACCATGAAATATGG + Intergenic
959391086 3:105774453-105774475 TCCAAAAGGAGCATGAAATTTGG + Intronic
960136289 3:114108900-114108922 GGCAGGTGGATCATGAAATCAGG + Intergenic
960390957 3:117077049-117077071 TCCAAGAGGAAGATGTAATTTGG + Intronic
961079143 3:124010100-124010122 TCCTGGAGGGTCATGCATTTAGG + Intergenic
961304331 3:125946369-125946391 TCCTGGAGGGTCATGCATTTAGG - Intergenic
961542987 3:127612798-127612820 GCCAGGAGGAGCATGAGCTTTGG + Intronic
961725922 3:128930378-128930400 GGCAGGCGGATCATGAAATCAGG - Intronic
961914605 3:130360152-130360174 TCTAGGAAGAGCATGTAATTTGG - Intronic
963646088 3:147916210-147916232 ACCATCAGGATGATGAAATTTGG - Intergenic
964441203 3:156712179-156712201 TCCAGGAAGTACATGAATTTTGG + Intergenic
968242888 3:197107825-197107847 TCCTGGAGGTTCTAGAAATTAGG - Intronic
968984403 4:3867302-3867324 TCCAGGAGAGACATGAAATGAGG + Intergenic
970617733 4:17783080-17783102 GCCAGGTGGCTCATGATATTTGG + Intergenic
972334488 4:38095206-38095228 TTCAGGAGGATCAGGTGATTTGG - Intronic
975270704 4:72429550-72429572 TTCAGGATGATCATGCACTTTGG - Intronic
976303854 4:83540235-83540257 TCCAAGAGGATTTGGAAATTAGG + Intronic
978587886 4:110292995-110293017 TCCAGGAAGATGGTGACATTTGG - Intergenic
980617451 4:135249196-135249218 TCCAGCAGGGGCATGAAATGAGG + Intergenic
980830032 4:138120092-138120114 GGCAGGAGGATCATGAAGTCAGG + Intergenic
981419751 4:144535608-144535630 GACAGGAGAATCATGAAAGTTGG - Intergenic
982908086 4:161102805-161102827 GGCAGGAGGATCATGAGATCAGG - Intergenic
984519633 4:180786418-180786440 GGCAGGAGGATCATGAAGTCAGG + Intergenic
984626477 4:182012761-182012783 GTCACAAGGATCATGAAATTTGG + Intergenic
985754225 5:1703642-1703664 TCCAGGAGGATCATGGTGCTGGG - Intergenic
986822750 5:11485735-11485757 TCCAGGAAGATCAACATATTTGG + Intronic
989155212 5:38338416-38338438 CCCAGGAGGCTCATGCATTTTGG + Intronic
989443104 5:41495138-41495160 TCCAGCAGAGTCATGCAATTGGG + Intronic
990011843 5:51008806-51008828 TGCAGGTGGATCATGAGGTTAGG + Intergenic
991630561 5:68652665-68652687 TCCAAGAGCACCATAAAATTAGG + Intergenic
992423658 5:76633083-76633105 TCCAGGATGAATTTGAAATTAGG - Intronic
992423843 5:76635161-76635183 TCCAGGATGAATATGAAATTAGG - Intronic
993428626 5:87801866-87801888 ACCAGGTGAATCATGAAATTTGG + Intergenic
993528405 5:88995318-88995340 CCCAGGAGAATCAGGGAATTCGG - Intergenic
995025341 5:107414217-107414239 TCCAGACAGATCACGAAATTTGG + Intronic
995737722 5:115320303-115320325 TAGAGCAGGATCATGGAATTTGG + Intergenic
996754582 5:126922193-126922215 TCCAGGAGAATCATGAGTTAGGG + Intronic
997789117 5:136740920-136740942 TCCAGGATGATCTTGAATTCCGG + Intergenic
998441059 5:142162396-142162418 ATCAGAAGGATTATGAAATTTGG - Intergenic
1000027904 5:157376054-157376076 TTCAGGAGGAGGATGAAATCAGG - Intronic
1001114570 5:168928795-168928817 TCCAGAAATATCATGAAAATGGG - Intronic
1002916419 6:1531638-1531660 CGCAGGTGGATCATGAAGTTAGG - Intergenic
1005697772 6:28367143-28367165 GGCAGGAGGATCATGAGGTTAGG - Exonic
1005753999 6:28909423-28909445 TCCTGGAAGGTCATGGAATTGGG - Intronic
1006239572 6:32665397-32665419 TCCAGGAGCTTCATGAAAAATGG - Intronic
1006811473 6:36823087-36823109 TCCAGGAGGTTCCTGAAAGAGGG + Exonic
1007875626 6:45097922-45097944 TGCAGAAAAATCATGAAATTTGG + Intronic
1008114410 6:47531232-47531254 TGTAGGAGCATCATGAAATAAGG - Intronic
1008872081 6:56284539-56284561 TCCAGGAGAATAATGACATTGGG - Intronic
1012248227 6:96951302-96951324 TCCTGGAGTATTATGAATTTGGG + Intronic
1012310204 6:97714631-97714653 TTCAGGAAGATGAAGAAATTGGG + Intergenic
1014825522 6:126045469-126045491 ATCAGGTTGATCATGAAATTTGG - Intergenic
1018598230 6:165507466-165507488 TCCAGGTAGATCATGATAGTAGG - Intronic
1018662191 6:166098463-166098485 TCCAGGAAGATGAGGATATTCGG - Intergenic
1023113102 7:36834082-36834104 TTCAGGAAGAACATGAATTTTGG - Intergenic
1024583822 7:50823798-50823820 GGCAGGTGGATCACGAAATTAGG - Intergenic
1029154252 7:98503704-98503726 TCCAGGAAGGACATGAATTTTGG - Intergenic
1030188327 7:106785798-106785820 TTCAGGAGTATCATGGAATTAGG - Intergenic
1030538999 7:110805313-110805335 TCCAGGAGGGTAATGAATTATGG + Intronic
1030636773 7:111959033-111959055 TCCAGCAGGTGCATGAAATGTGG - Intronic
1032122091 7:129164010-129164032 GCCAGGAGGACTACGAAATTCGG - Intronic
1032997342 7:137462729-137462751 TCCAGTGTGTTCATGAAATTAGG - Intronic
1034624839 7:152484715-152484737 GGCAGGAGGATCATGAAGTCAGG - Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1037881277 8:22574672-22574694 TCCCGGAGGACCCAGAAATTCGG + Exonic
1041979504 8:63840748-63840770 TCCAGGATATTCATCAAATTCGG + Intergenic
1042813402 8:72851070-72851092 TCTAGGAAGATAATGAAGTTTGG - Intronic
1043043307 8:75289631-75289653 TCCATGAGGATGAGGATATTTGG - Intergenic
1045313598 8:101025041-101025063 GGCAGGAGGATCATGAGATTGGG + Intergenic
1045512274 8:102821264-102821286 TCCAGCAGAATCATAGAATTAGG + Intergenic
1045914726 8:107454105-107454127 ACCAGAAGGAACATGAAAATAGG - Intronic
1047343349 8:124003694-124003716 GGCAGGAGGATCATGAGATCAGG - Intronic
1051924015 9:22301123-22301145 TCCAGAAGAAACATGAAAATTGG + Intergenic
1053624580 9:39855681-39855703 GGCAGGAGGATCATGAATTCAGG - Intergenic
1053646210 9:40120920-40120942 GGCAGGAGGATCATGAAACCAGG + Intergenic
1053759506 9:41342620-41342642 GGCAGGAGGATCATGAAATCAGG - Intergenic
1053880291 9:42587547-42587569 GGCAGGAGGATCATGAATTCAGG + Intergenic
1054219317 9:62395017-62395039 GGCAGGAGGATCATGAATTCAGG + Intergenic
1054231397 9:62514156-62514178 GGCAGGAGGATCATGAATTCAGG - Intergenic
1054327222 9:63718817-63718839 GGCAGGAGGATCATGAAATCAGG + Intergenic
1054538360 9:66255056-66255078 GGCAGGAGGATCATGAAACCAGG - Intergenic
1055339524 9:75266114-75266136 TTCAGCAGAGTCATGAAATTGGG + Intergenic
1056264543 9:84883244-84883266 TCCAGAAGGACCATGAAGCTGGG + Intronic
1056423407 9:86452565-86452587 TCCTGCAGGATCAAGCAATTAGG + Intergenic
1056489320 9:87089340-87089362 TCCAGGAGGAACATGAGACATGG - Intergenic
1058792931 9:108469410-108469432 TCTAGGAGGATCTGGAAGTTTGG - Intergenic
1060825267 9:126684125-126684147 TCCATGGGGACCATGAGATTTGG - Intronic
1202794000 9_KI270719v1_random:104362-104384 GGCAGGAGGATCATGAAACCAGG + Intergenic
1187339679 X:18409916-18409938 GGCAGGAGGATCATGAAGTCAGG - Intergenic
1187980420 X:24750834-24750856 TACAGGAAGATCATGATTTTTGG + Intronic
1189971079 X:46418918-46418940 CCCAGGAAGATCAAGAAAGTGGG - Intergenic
1190899315 X:54653713-54653735 GGCAGGCGGATCATGAGATTAGG + Intergenic
1192104424 X:68300159-68300181 TGGAGGAGGATGATGAAACTAGG - Intronic
1194280795 X:91951494-91951516 TCATAGAGGATTATGAAATTTGG + Intronic
1195975431 X:110521287-110521309 CCCAGGAGGAGCCTGCAATTCGG + Intergenic
1199319238 X:146419125-146419147 GGCAGGTGGATCATGAAATCAGG + Intergenic
1200255750 X:154581713-154581735 TCCAGGAGGGTCATAAGGTTTGG - Intergenic
1200262019 X:154622691-154622713 TCCAGGAGGGTCATAAGGTTTGG + Intergenic
1200598278 Y:5175058-5175080 TCATAGAGGATTATGAAATTTGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201149304 Y:11087060-11087082 GGCAGGAGGATCATGAAATCAGG - Intergenic
1201889179 Y:18922771-18922793 GGCAGGAGGATCATGAAGTCAGG - Intergenic