ID: 1157636913

View in Genome Browser
Species Human (GRCh38)
Location 18:49167046-49167068
Sequence CTCTGATAGTGCACTAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157636913 Original CRISPR CTCTGATAGTGCACTAATAG GGG (reversed) Intronic
917496232 1:175542540-175542562 ATCTGACAGAGCCCTAATAGAGG + Intronic
917665072 1:177218398-177218420 CTCTGATTGAGCACGACTAGTGG + Intronic
918960212 1:191266020-191266042 TTCTGACACTGCTCTAATAGGGG + Intergenic
922128116 1:222749360-222749382 TTCTGATAGTATAGTAATAGTGG - Intronic
1072551391 10:96480217-96480239 CTCTGATTTTCCACAAATAGGGG + Intronic
1077564165 11:3285881-3285903 TTCTGTCAGTGCACTTATAGGGG + Intergenic
1077570055 11:3331698-3331720 TTCTGTCAGTGCACTTATAGGGG + Intergenic
1078292055 11:10021777-10021799 CTCTGATAATGGCCTAATATTGG + Intronic
1080252627 11:30251900-30251922 CTCACATAGTGAAATAATAGAGG - Intergenic
1091010916 11:131999529-131999551 CTCTGAAAGTGAACTAATGGTGG - Intronic
1093012023 12:14117243-14117265 CTCTGATACTTCTCTAGTAGGGG - Intergenic
1095270647 12:40214718-40214740 ATCTGATGGTGCCTTAATAGTGG + Intronic
1097459193 12:59839248-59839270 CTCTGTTATTGTACTAATAAAGG - Intergenic
1097977634 12:65705360-65705382 CTCTGATACTGCAACAATGGTGG - Intergenic
1101756532 12:107625445-107625467 CTCTGATACTGCTCTGACAGGGG + Intronic
1104371289 12:128225939-128225961 CAGTAATAGGGCACTAATAGAGG + Intergenic
1111818097 13:93180110-93180132 CTCAGAGAATGCTCTAATAGTGG - Intergenic
1115856438 14:37633962-37633984 CTCTGACACTGCTCTAAAAGAGG - Intronic
1118561397 14:67087221-67087243 TTTGAATAGTGCACTAATAGTGG - Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1123391980 15:19885051-19885073 CTCTGATAGTAAACTAATCTTGG + Intergenic
1124891229 15:33735034-33735056 CTCTAAAAGTACAGTAATAGGGG - Intronic
1126273063 15:46844768-46844790 TTCTGCTATTGCTCTAATAGAGG + Intergenic
1127200238 15:56638431-56638453 CTTTGATACTGCACCAAAAGTGG - Intronic
1128849528 15:70939149-70939171 CTCTAACACTGCAATAATAGTGG - Intronic
1140218606 16:73027808-73027830 CTCTGATAGTGGATCAATAAAGG - Intronic
1141316888 16:82970775-82970797 CTCTAATAGGGAAATAATAGAGG - Intronic
1144141452 17:12352549-12352571 CTCTGCTAATGCACTTAAAGCGG + Intergenic
1148516723 17:48225792-48225814 ATCTGAAAGTGCAGTAATAAGGG + Intronic
1157636913 18:49167046-49167068 CTCTGATAGTGCACTAATAGGGG - Intronic
928063715 2:28141493-28141515 CTCTCATTCTGCAGTAATAGGGG - Intronic
935026646 2:99283339-99283361 CTGTGATAATGGACTAATACAGG + Intronic
939697555 2:145345144-145345166 CTGTGCTAGTGCACTTTTAGGGG - Intergenic
940769765 2:157827565-157827587 CTCTGATTGTGTAATAATTGGGG + Intronic
1179905475 21:44420537-44420559 CTCTGATGGTCCACTTACAGAGG + Intronic
1184926898 22:47648673-47648695 ATCTGACAGTGCACTCCTAGGGG + Intergenic
952022664 3:29041770-29041792 CTCTGATAGTGCTCTGGTCGGGG + Intergenic
959389891 3:105760425-105760447 CTCTGAAAGTTCACCAATACAGG + Intronic
962193055 3:133331438-133331460 CTCTGATGGAACATTAATAGAGG + Intronic
962366141 3:134784800-134784822 CTTTGATAGTTCTATAATAGGGG + Intronic
963323385 3:143834637-143834659 CTCTGCTTGGGAACTAATAGTGG - Intronic
965913053 3:173805068-173805090 CTCTGACAATGCACTATTAAAGG + Intronic
972986120 4:44768286-44768308 TTCTGATAATGCCCTAATAAGGG + Intergenic
973719550 4:53709286-53709308 CTCTGATGGTGCAATAATCACGG - Intronic
974821830 4:67076590-67076612 CTCTAATAGGCCACTATTAGAGG + Intergenic
983823408 4:172225983-172226005 CCTTGCTAGAGCACTAATAGTGG + Intronic
984388219 4:179092511-179092533 CCCTGATAGGGCAGTAATAATGG - Intergenic
987653688 5:20777344-20777366 ATCTGTAAGTGCACCAATAGTGG - Intergenic
988741890 5:34084149-34084171 ATCTGTAAGTGCACCAATAGTGG + Intronic
989105399 5:37858475-37858497 GTCTAAAAGTGCACTAATAAAGG - Intergenic
991194332 5:63914899-63914921 ATTTGATAGTACTCTAATAGGGG - Intergenic
991383223 5:66054758-66054780 CTCTGGTATTTCATTAATAGAGG - Exonic
993207153 5:84895925-84895947 CTCAGATAGTGCCCAAATGGAGG - Intergenic
994239333 5:97402611-97402633 CTCTGATGGTGCCCTAGAAGTGG + Intergenic
1007185435 6:39967146-39967168 CTCTGACACTGCACTGATAGGGG - Intergenic
1009897622 6:69772863-69772885 CTCTGTTAGTGCAATGATATAGG - Intronic
1012864737 6:104604821-104604843 CACTGATAGTAAATTAATAGTGG + Intergenic
1014786589 6:125626366-125626388 CTCTGATGGTGTTCTAATGGAGG - Intergenic
1020062857 7:5165563-5165585 CTCTGAGAGAGCTCTAACAGTGG + Intergenic
1020165400 7:5803775-5803797 CTCTGAGAGAGCTCTAAGAGTGG - Intergenic
1020510499 7:9050222-9050244 CTCTGACACTGCTGTAATAGTGG - Intergenic
1033807560 7:144972258-144972280 CTTGGATAGTACAATAATAGAGG - Intergenic
1043946468 8:86259674-86259696 CTCTGGAATTGCACTAATAATGG - Intronic
1045967702 8:108044381-108044403 CTCTGAGAGTGCACAGAGAGGGG - Intronic
1050275481 9:3993519-3993541 CTCAGATAGTGGACTTATTGTGG - Intronic
1052093126 9:24354492-24354514 CTCTAATAGTGCACTCAAAAAGG - Intergenic
1052524763 9:29601514-29601536 CTCAGATCCTGCAATAATAGAGG - Intergenic
1186770300 X:12811607-12811629 CTCTAAATGTGCACTAATAGAGG + Intronic