ID: 1157637550

View in Genome Browser
Species Human (GRCh38)
Location 18:49174614-49174636
Sequence ATTCCCTGAGTCACAAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157637548_1157637550 8 Left 1157637548 18:49174583-49174605 CCTGAAAAAAGTGAGATTATGAC No data
Right 1157637550 18:49174614-49174636 ATTCCCTGAGTCACAAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157637550 Original CRISPR ATTCCCTGAGTCACAAAGAT TGG Intronic