ID: 1157639679

View in Genome Browser
Species Human (GRCh38)
Location 18:49202035-49202057
Sequence TGTTGGGTAAGAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157639679_1157639686 2 Left 1157639679 18:49202035-49202057 CCATCTTCCCTTCTTACCCAACA 0: 1
1: 0
2: 2
3: 46
4: 516
Right 1157639686 18:49202060-49202082 AGAATACTTAGCAGGCCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 125
1157639679_1157639685 1 Left 1157639679 18:49202035-49202057 CCATCTTCCCTTCTTACCCAACA 0: 1
1: 0
2: 2
3: 46
4: 516
Right 1157639685 18:49202059-49202081 CAGAATACTTAGCAGGCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 102
1157639679_1157639684 -6 Left 1157639679 18:49202035-49202057 CCATCTTCCCTTCTTACCCAACA 0: 1
1: 0
2: 2
3: 46
4: 516
Right 1157639684 18:49202052-49202074 CCAACAGCAGAATACTTAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157639679 Original CRISPR TGTTGGGTAAGAAGGGAAGA TGG (reversed) Intronic
900668582 1:3834251-3834273 TACTCGGTATGAAGGGAAGATGG - Intronic
901301542 1:8203223-8203245 TGTGGGGTTAGAAGTCAAGAAGG + Intergenic
901722644 1:11212303-11212325 AGCTGGGGAAGAAGGTAAGATGG - Exonic
901774664 1:11552070-11552092 TGTAGTGAATGAAGGGAAGATGG + Intergenic
901779235 1:11582061-11582083 TGTTGGGGAGGAAAGGAAGGCGG + Intergenic
903757478 1:25672704-25672726 TGTTGGGTTACAAGGTAAGATGG - Intronic
903848949 1:26294971-26294993 TGTTGGATAGGAAGGGGAAACGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904301699 1:29558405-29558427 TGTTGGGAAAGAATGGAGGGTGG - Intergenic
904381424 1:30113765-30113787 TGTGGGGAGAGATGGGAAGAAGG + Intergenic
904644821 1:31957829-31957851 TGAGGGGTAGAAAGGGAAGAGGG - Intergenic
905409515 1:37758711-37758733 TGTGGGGTAAGAAGCCAAGAGGG - Intronic
907718621 1:56951028-56951050 TGTTGGGGAGGAAGGGAAGGAGG + Intronic
908522316 1:64956279-64956301 TGATGGGTCAGAAAGAAAGACGG + Intronic
909587906 1:77311982-77312004 TGTAGGGGAGGAAGGGATGAGGG - Intronic
910243952 1:85119332-85119354 GGTAGGGAAAGAAAGGAAGAGGG - Intronic
910932068 1:92452722-92452744 TCTTGGGTGAGTAGGGAAGGTGG - Intergenic
911030781 1:93485224-93485246 TGTGTGGGAAGATGGGAAGATGG + Intronic
911318963 1:96388781-96388803 TTTTAGTTAAGAAAGGAAGAGGG - Intergenic
911445632 1:97988148-97988170 TGTGGGGTAAGAGGGAGAGAGGG + Intergenic
911480780 1:98437597-98437619 TGTTGGCTAAGATGGGAAAAAGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912535972 1:110371278-110371300 AGTTGGGAAAGAGGGGAATATGG + Intronic
912699244 1:111864167-111864189 GGATGGGGAAGAAGAGAAGAAGG + Intronic
913349640 1:117843031-117843053 TGTTGGGGAAGACGGCCAGAGGG - Intergenic
914351479 1:146843700-146843722 TCCTGGTTAAGAGGGGAAGACGG + Intergenic
915091231 1:153427893-153427915 TGTTTTGTAAGATGGGAAGAGGG - Intergenic
915093878 1:153445396-153445418 TGCTTTGTAAGATGGGAAGAGGG + Intergenic
915117818 1:153611347-153611369 TGTGGGGTGAGAAGAGAAGGTGG - Intronic
915268241 1:154733818-154733840 TGTTGGGGATGAAGGGAGGGAGG - Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915601204 1:156924253-156924275 TGCTGGGTTGGAAAGGAAGACGG - Intronic
916051917 1:161042349-161042371 TGTGGGGAAAGAAGGGAGAATGG - Intronic
916070736 1:161168232-161168254 GGTGGGGTATGAAGAGAAGAGGG - Intronic
916189237 1:162162950-162162972 TGTTGGGGAATCAGGGATGATGG - Intronic
916265205 1:162883650-162883672 TGTTGGGTTGGATGGGAAGCAGG - Intergenic
916513378 1:165493362-165493384 TGATGGATAAGAACTGAAGATGG + Intergenic
916658778 1:166901731-166901753 TGTGGGGGAACTAGGGAAGAAGG - Intergenic
916658861 1:166902315-166902337 TGTTGGGAAGGACAGGAAGAAGG - Intergenic
916732221 1:167576473-167576495 TGTAGAATAAGAAGGAAAGACGG - Intergenic
917166620 1:172119573-172119595 ATTTGGGTGAGAAGAGAAGAGGG - Intronic
917840496 1:178973681-178973703 TGAGGGGTAAGGAGGGATGAGGG + Intergenic
918018232 1:180659269-180659291 TGATGGGAAAGAAGGGAGGGAGG - Intronic
918352832 1:183675376-183675398 TGGTAGGTAGGAAGGAAAGAAGG - Intronic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919019661 1:192087975-192087997 TGTTGGGGTAGCAGGGAAGAAGG + Intergenic
919077725 1:192832983-192833005 TGTTATGGAAGAAGGGGAGAAGG + Intergenic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
920203208 1:204273458-204273480 TGGAGAGTAGGAAGGGAAGAGGG - Intronic
920862557 1:209722452-209722474 TGTTGAGTGAAAAGAGAAGAGGG - Intronic
921451116 1:215306926-215306948 AGTTGAGGAAGAAGGGGAGAAGG - Intergenic
922340571 1:224651951-224651973 TGTTGAGGAAGCAGGGAAAAAGG - Intronic
922788280 1:228294556-228294578 TCCTGGATAAGAAGGGAGGAGGG - Intronic
923178266 1:231490465-231490487 TGTAGAGTAAGAAGTGAAAAGGG + Intergenic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
923437719 1:233983634-233983656 TGATGGCTAGCAAGGGAAGAAGG - Intronic
924009282 1:239646912-239646934 TCTGGGGTAAGAAGAGATGAAGG + Intronic
924210353 1:241759485-241759507 TATAGGTTAAGAAGGGAACAAGG - Intronic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924599212 1:245473572-245473594 GGTTGGGGGAGAAAGGAAGAAGG + Intronic
1062928405 10:1335446-1335468 GGATGGGTAAACAGGGAAGAAGG + Intronic
1063853540 10:10221328-10221350 TGTTGAGAAAGAATGGGAGATGG + Intergenic
1063994892 10:11610753-11610775 TGTTGGGAAAGAAAGGGATAAGG + Intronic
1065329412 10:24578868-24578890 TGTTGTGTATGATGGGAAGTGGG - Intergenic
1066445789 10:35481544-35481566 AGTTGGGCATGAAGGGAATAAGG + Intronic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1068933302 10:62612981-62613003 TGTTGTTTCAGAAGGGAGGAAGG + Intronic
1069247341 10:66222511-66222533 AGTTGGGAAGGAAGGAAAGAAGG + Intronic
1071128202 10:82360166-82360188 GGTTGGGGAAGAAGGGGAGTGGG + Intronic
1071207827 10:83302407-83302429 TGATGGGGAAGAAGAGAGGAGGG - Intergenic
1071921458 10:90355525-90355547 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1072377345 10:94831006-94831028 TGGGGGGTGAGAAGGGAAGTAGG - Intronic
1072533265 10:96339410-96339432 TGTTGGTTAAGAATGTAATACGG - Intergenic
1072858866 10:98981714-98981736 TGAGGGGTTAGAAGGGGAGAAGG - Intronic
1073017991 10:100417314-100417336 AGTTGTTTATGAAGGGAAGAAGG + Intergenic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1074675848 10:115850141-115850163 AGATGGGTAAGAGGGGTAGATGG + Intronic
1075394743 10:122119129-122119151 TCTGGGGAGAGAAGGGAAGAAGG - Intronic
1075468020 10:122666028-122666050 TGTAGGATAAGAAGATAAGAGGG - Intergenic
1075624332 10:123950882-123950904 TGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1075685867 10:124364754-124364776 TGGTGGGAAAGAAGGGAGCAGGG + Intergenic
1076111003 10:127859644-127859666 TCTTGGGGGAGAAGGAAAGATGG - Intergenic
1076113696 10:127880758-127880780 TGTTGGGTAGGGAAGGAAGTGGG - Intronic
1076725182 10:132409766-132409788 TGCTGAGAAGGAAGGGAAGAGGG + Intronic
1077422935 11:2461434-2461456 TGCAGGGGAGGAAGGGAAGAGGG - Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1080156129 11:29113290-29113312 TGTTAGGTATGAAAGTAAGAAGG - Intergenic
1080384549 11:31803497-31803519 TGTTTGGTTAGAATAGAAGAAGG + Intronic
1080928700 11:36784964-36784986 GGTGGGGGAAGAAGGGAAGGAGG - Intergenic
1081560800 11:44214437-44214459 GGTTGGGAACGAAGGGAACATGG - Intronic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1083612089 11:64009203-64009225 TGTATGGTAAGAAGGGAGGCAGG - Intronic
1085329595 11:75636847-75636869 AGTTGGGTCAGGAGGCAAGAAGG - Intronic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1086019348 11:82207558-82207580 TGCTGGGCAATAAGGCAAGATGG + Intergenic
1088966191 11:114723825-114723847 TGATAGGTAAGCATGGAAGAAGG + Intergenic
1089158169 11:116417670-116417692 GGATGGGAAAGAATGGAAGAAGG + Intergenic
1090178003 11:124668899-124668921 TTTAAGGTAAGAAGGTAAGAAGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091007700 11:131968473-131968495 TGCTGGGTACGATTGGAAGAAGG - Intronic
1091056128 11:132420707-132420729 GGTGGGGTAGGAAGGGGAGACGG + Intronic
1091069970 11:132553936-132553958 AATTGGGAAAGAAGGGAAGGAGG - Intronic
1091121604 11:133062593-133062615 TGTAGGGAAAGGAGGGATGAAGG - Intronic
1091687041 12:2570249-2570271 TGATGGGTAAAAAGGGATGGAGG + Intronic
1091808182 12:3371468-3371490 TTTTTGGAAAGAAGGGAATAAGG + Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1093257046 12:16881479-16881501 TGATGGGTTAGAAAGAAAGAGGG + Intergenic
1093611438 12:21163903-21163925 TGTAGAGTAAAAAGAGAAGACGG + Intronic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094002542 12:25710955-25710977 TGATGGGAAAGAAAAGAAGATGG + Intergenic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1094130149 12:27065923-27065945 AGATGGGGAAGAATGGAAGAAGG + Intronic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097540098 12:60931471-60931493 GGTTAAGTGAGAAGGGAAGATGG - Intergenic
1098603741 12:72364702-72364724 TGTTGATTTAGAAAGGAAGATGG + Intronic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1099952668 12:89321730-89321752 TGTTGGGAAACAAGAGAAGTTGG + Intergenic
1100162180 12:91873118-91873140 TGATGGGTAAGAAGCAAAGCAGG + Intergenic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102317612 12:111902430-111902452 TTTTAGGTAAAAAGGGAGGATGG - Intergenic
1102411648 12:112725370-112725392 TGGTGGAGAAGAGGGGAAGAGGG + Intronic
1102624170 12:114221026-114221048 TGATAGTTAAGAGGGGAAGAAGG + Intergenic
1102776864 12:115527276-115527298 TGTTGAATTAGAATGGAAGAAGG + Intergenic
1102819354 12:115894782-115894804 TGTTGAGTGAGAAGGGAGCAAGG + Intergenic
1103082909 12:118039566-118039588 TGCAGGGGAAGAAGGGAGGATGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103487833 12:121295425-121295447 TGTGGGGTGATTAGGGAAGAGGG + Intronic
1106470599 13:30050745-30050767 TGTTAGAAAAGAAGGGAAGAGGG + Intergenic
1107534532 13:41315140-41315162 TGTTGGGGAAGGAAGGAGGATGG + Intronic
1108191625 13:47946465-47946487 TGTTGGGGAAGAAGTAAAGAGGG + Intronic
1108394905 13:49982518-49982540 TGTGGGGTATGCAGGGAAGAAGG + Intergenic
1108557856 13:51613280-51613302 GCTTGGGAAAGAAGGGGAGATGG - Intronic
1109379770 13:61543986-61544008 TGTTGGGGAAGAAAGGAGCAGGG + Intergenic
1109498701 13:63210274-63210296 TCTGGGGTAAGAAAGCAAGAGGG - Intergenic
1109934842 13:69268268-69268290 AGTTGGCCAAGAATGGAAGAGGG - Intergenic
1110798590 13:79669326-79669348 TGTAGAGTAAGAAGGAAAGTGGG - Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111343528 13:86919008-86919030 TGATTGGCAAGAAGGGAAGATGG + Intergenic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1112259858 13:97868178-97868200 TGTTGGGAAACAAGGGGTGAAGG + Intergenic
1112731834 13:102371421-102371443 TGCTGGCTAAGAAGGGAATAAGG - Intronic
1113164948 13:107429625-107429647 TGTTGAGTAAGAAGGAGTGAAGG - Intronic
1113389113 13:109878761-109878783 CGTTGGGAAATAACGGAAGAAGG - Intergenic
1113774691 13:112936519-112936541 TTTTGGGGAAGAAGAGAAGGAGG + Intronic
1114371486 14:22093941-22093963 TGATGGGTAAGTAGGAAGGACGG + Intergenic
1114661663 14:24350009-24350031 TATGGAGGAAGAAGGGAAGAAGG + Intergenic
1114925787 14:27395943-27395965 TGTGGGGCACGAGGGGAAGAAGG + Intergenic
1115429824 14:33303564-33303586 TTTTGGGGAACAATGGAAGATGG + Intronic
1115982888 14:39073166-39073188 TGCTGAGTAAAAAGGGAACAAGG - Intronic
1116593574 14:46810988-46811010 TGTGAGGCAAGAAGAGAAGAGGG + Intergenic
1116945509 14:50831422-50831444 TGTTGGGAAAGAAAGGGAGGCGG - Intergenic
1117441400 14:55762800-55762822 TGTTGAGTAAGAATGAAGGATGG - Intergenic
1117783434 14:59258120-59258142 TGCTGGGCACTAAGGGAAGAGGG - Intronic
1117902872 14:60553251-60553273 TGTAAAGTAATAAGGGAAGAGGG + Intergenic
1118765046 14:68904037-68904059 TGTTGGGTAGGGAAGGAAGGAGG - Intronic
1118916735 14:70114048-70114070 TCTTGGGGAAGAAGGTAAAAGGG - Intronic
1119427213 14:74543557-74543579 TGTGGGGAAGGAAGGGAGGAAGG - Intronic
1119667587 14:76496389-76496411 GGTTCGGTAGGATGGGAAGAGGG + Intronic
1119976279 14:79027842-79027864 TGTGGGGGAAGAGGGGAAGAGGG - Intronic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121037407 14:90717865-90717887 TGTTGGGGAAGCAGGGTGGATGG - Intronic
1121452953 14:94021036-94021058 TGCTGGGGAAGAAGAGAATAGGG - Intergenic
1121515655 14:94548205-94548227 TGTGGGGTAGAAAGGGGAGAGGG + Intergenic
1121715895 14:96074022-96074044 TGTTGGGAAGGGTGGGAAGAGGG + Intronic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1121834675 14:97081102-97081124 TTTTGGGGAAGAGGGGAAGGAGG + Intergenic
1122021173 14:98839178-98839200 AATGGGGTAAGAGGGGAAGAAGG - Intergenic
1124065277 15:26337273-26337295 TATTGGTTAATAAAGGAAGAAGG - Intergenic
1124157393 15:27237976-27237998 TGTCTGGGAAGAAGGAAAGAAGG + Intronic
1124960032 15:34387006-34387028 TGATGGGGAAGAAAGGAAGTCGG - Intronic
1124976661 15:34533227-34533249 TGATGGGGAAGAAAGGAAGTCGG - Intronic
1126121155 15:45252786-45252808 TGCTGAGTAAGAAGGAAACAGGG - Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127264436 15:57350107-57350129 AGTTGAGTAAGAAGGACAGAGGG - Intergenic
1127290115 15:57562522-57562544 CGCTGGGTAATAAGGGAAGCAGG - Intergenic
1128371304 15:67041334-67041356 GGAAGGGAAAGAAGGGAAGAAGG + Intergenic
1129085077 15:73080794-73080816 AGTTGGGTAGGACTGGAAGAAGG + Intronic
1129194355 15:73955323-73955345 TGCTGGGTCAGGAGTGAAGATGG - Intergenic
1130054834 15:80513549-80513571 TTTTAGGAAAGAAGGGAAGAGGG - Intronic
1130578231 15:85112484-85112506 TGTTGGGTAAAATGGAAAGTTGG + Intronic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1132322776 15:100938560-100938582 TGTGGGGGAAGGAGGGAGGATGG - Intronic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133408536 16:5548221-5548243 TGGTGGGGGAGAAAGGAAGAAGG + Intergenic
1134023697 16:10939285-10939307 TGAGGGGTAAGAGGGGAAGCAGG - Intronic
1134444472 16:14320450-14320472 GCTTAGGGAAGAAGGGAAGAAGG - Intergenic
1134543863 16:15092735-15092757 TGTTGGTTAAGAGTGGAAGCAGG - Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135361440 16:21818882-21818904 TGTTGGTTAAGAGTGGAAGCAGG - Intergenic
1137062614 16:35805371-35805393 AGCTGGGTAAGTAAGGAAGAAGG - Intergenic
1139982556 16:70871838-70871860 TCCTGGTTAAGAGGGGAAGACGG - Intronic
1140851009 16:78934602-78934624 TGGTGGGTCATAGGGGAAGAGGG - Intronic
1141205952 16:81933306-81933328 TGTTGGGGAGCAAAGGAAGAAGG + Intronic
1141243739 16:82287369-82287391 GGTAGGGTAAGAATGAAAGAAGG + Intergenic
1141450979 16:84101894-84101916 TGTTGGGCAAGACTGTAAGATGG - Exonic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141639110 16:85330834-85330856 CCTGGGGTAAGAAGGGAGGAGGG - Intergenic
1141892106 16:86933191-86933213 AGATGGGGAAGAAGGGAAGGAGG + Intergenic
1142024110 16:87803317-87803339 TGTTCTGAGAGAAGGGAAGAAGG - Intergenic
1142532269 17:588578-588600 TGAAAGGTAAAAAGGGAAGAGGG - Intronic
1144410446 17:14995373-14995395 AGTTGGGTGAGATGGGAAGCAGG + Intergenic
1144878524 17:18417408-18417430 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1144885229 17:18453832-18453854 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145018465 17:19413390-19413412 GCTGGGGAAAGAAGGGAAGAAGG + Exonic
1145146989 17:20490545-20490567 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145153711 17:20526979-20527001 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145177056 17:20709637-20709659 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145405295 17:22585062-22585084 TATTGGGAAAAAAGGGAAAAAGG + Intergenic
1146017735 17:29247302-29247324 AGTGGGGGAGGAAGGGAAGAAGG - Intronic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146896808 17:36547974-36547996 TGTTGGGAGAGAAGGGGAAAAGG + Intronic
1147403294 17:40193608-40193630 TGTAGAGGAAGAAGGGAAGCTGG + Intronic
1149330158 17:55572814-55572836 TGTTGGGGAAGAGGGGAATAGGG - Intergenic
1149393779 17:56218587-56218609 TGTTGGGCAAGAAGAAAAGGTGG - Intronic
1150073030 17:62168758-62168780 TGTTGGGTATGAGAGGAAGCTGG - Intergenic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1152506900 17:80755298-80755320 AGTTGGAGATGAAGGGAAGAGGG + Intronic
1153189623 18:2523289-2523311 AGTTGGGTAAAAAGGGAAGAAGG + Intergenic
1153289183 18:3483516-3483538 TGTGGGGAGAGAAGGGAAGATGG + Intergenic
1153923283 18:9810167-9810189 TGCTGGGTAGTCAGGGAAGAAGG + Intronic
1156351941 18:36309402-36309424 TGTTTGGCAAGAAGGGCAGTTGG - Intronic
1156369074 18:36456514-36456536 TCATGGGTAAGAATGGAATAGGG + Intronic
1156441635 18:37195255-37195277 TGAAGGCTAGGAAGGGAAGAGGG - Intronic
1156850495 18:41720200-41720222 GGATGGGTAGGAAGGGAGGAAGG - Intergenic
1157155013 18:45256785-45256807 TGTTGGGAAAGAAAGGGAAAAGG + Intronic
1157621875 18:49021439-49021461 TGTTGGGTGAGAAAGGTGGAGGG + Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1157899934 18:51505068-51505090 TGATGGGTGAGGAGTGAAGAGGG + Intergenic
1158685365 18:59609183-59609205 TGTGCAGTGAGAAGGGAAGATGG - Intronic
1159476209 18:68924115-68924137 TGGGGGGGAAGAAGGGAAAAGGG - Intronic
1159588261 18:70302658-70302680 AGCTGAGTAGGAAGGGAAGAGGG + Intronic
1159944107 18:74430915-74430937 TGCTGGCAGAGAAGGGAAGATGG - Intergenic
1160174581 18:76582235-76582257 TATTGGGTAGGAGGGGAAGGAGG - Intergenic
1160258964 18:77273337-77273359 TGATGAATAAGAAGGGAAGGTGG + Exonic
1160265035 18:77334989-77335011 TGTTGGCACAGAAGCGAAGATGG - Intergenic
1161252605 19:3288891-3288913 TGTGGGGTGGGAATGGAAGAAGG + Intronic
1161758903 19:6156290-6156312 AGTTGGGGAGGAAGGGAAGCTGG + Intronic
1161852800 19:6746292-6746314 GGTTGGGCAACCAGGGAAGAGGG - Intronic
1164243452 19:23410013-23410035 TGATGGGGAAGAAGGGAGGGAGG + Intergenic
1164399645 19:27893810-27893832 TGTTGGAAGAGAAGGGGAGAAGG - Intergenic
1164441134 19:28281771-28281793 GGTTGGAGAAGAAGAGAAGAGGG - Intergenic
1166073653 19:40401102-40401124 TATTGGGTATGATGGAAAGAGGG - Intronic
1166291969 19:41869209-41869231 AGATGGGTAAGCAGGGTAGAGGG + Exonic
1168656411 19:58132186-58132208 TGGTAGGTCACAAGGGAAGAGGG + Intronic
925680046 2:6411086-6411108 TGTTTGCTAAGAGGGGAAAATGG + Intergenic
925842252 2:8003552-8003574 TGCTGGAGAAGAAGGGAAGGAGG - Intergenic
926147972 2:10408341-10408363 GGATGGGTAAGAAGTCAAGAAGG + Intronic
926376969 2:12240105-12240127 TGTTGGGAAAAAAGAGAAGGTGG + Intergenic
926830136 2:16952729-16952751 TGCTGTGTTAGAAGGTAAGAGGG + Intergenic
926965814 2:18409462-18409484 TATAGGGTAAGAAAGAAAGAAGG + Intergenic
928378222 2:30796076-30796098 TTTTGGGGAAGAAAGGAAAAGGG - Intronic
928432920 2:31235022-31235044 TATTGGGTAGGATGGGAAGGGGG - Intronic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
929579344 2:43071787-43071809 AGTGGGGAAAGAGGGGAAGAGGG - Intergenic
929632933 2:43484377-43484399 TTTTAGGGAAGAAGGGAATAGGG + Intronic
929787169 2:45001319-45001341 TGGTGAGCAGGAAGGGAAGAAGG - Intergenic
930667766 2:54116061-54116083 AGTTGGGTAGGAAAAGAAGAGGG + Intronic
931256641 2:60579980-60580002 TTTTATGTAAGAAGGGAAAATGG - Intergenic
931798149 2:65731736-65731758 GGCTGGCCAAGAAGGGAAGATGG + Intergenic
932176125 2:69604496-69604518 GGTGGGGCAAGAAGGTAAGAGGG - Intronic
932336661 2:70935677-70935699 TGTGGAGGGAGAAGGGAAGAGGG - Intergenic
932375791 2:71234671-71234693 TGTAGGGCAAGAGGGTAAGAGGG + Intergenic
933989791 2:87625905-87625927 TGTTGGGTAAGAGGGTCAGTTGG - Intergenic
934897664 2:98132692-98132714 TGTAGGGCAAGGAGGGGAGATGG - Intronic
935082414 2:99811050-99811072 TGTTAGGTAACATGGCAAGAGGG - Intronic
935432417 2:102990357-102990379 TGATGGGCAAGGAGGGAAGGAGG + Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
935880463 2:107559745-107559767 GGCTGGCAAAGAAGGGAAGATGG - Intergenic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936304053 2:111324921-111324943 TGTTGGGTAAGAGGGTCAGTTGG + Intergenic
936657340 2:114503643-114503665 TGTGGGACAAGAAGGGAAGGGGG + Intronic
936710005 2:115121305-115121327 TGTTGGGTAATGGGGGAAAATGG - Intronic
936895186 2:117419858-117419880 TGTGGCGGAAGAAGAGAAGAAGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939015008 2:136892393-136892415 TGTTATGTAAGAAGGGAAATTGG + Intronic
940661818 2:156554561-156554583 TTTAGGGGAAGAGGGGAAGAAGG + Intronic
941317269 2:164008852-164008874 TGTAGTGTAAGGAGGGACGAGGG + Intergenic
941932156 2:170952992-170953014 TGTGAGGGAAGAAGGGAAGAAGG + Intronic
942239671 2:173949038-173949060 TGTTGTGTAAGAGGGGCAAAAGG + Intronic
942314717 2:174687087-174687109 TGTTGGGAAGGAAGGAAGGAAGG + Intergenic
942893611 2:181021663-181021685 AGTTGGGAAGGAAGGAAAGAAGG - Intronic
943335330 2:186606599-186606621 AGTTGGGGAAGAAAGGAAAAGGG - Intronic
943631950 2:190263788-190263810 TGTGGGGTAGAAAGGAAAGAAGG - Intronic
943676964 2:190725125-190725147 TGTTGGGTAAGAGGTGAGGCGGG - Intergenic
943838132 2:192541837-192541859 TGTTTTGTAAGAAGGGAAAAAGG + Intergenic
943879679 2:193125383-193125405 TGTGGGGCAAGAGTGGAAGAGGG + Intergenic
944081942 2:195797801-195797823 CATTGAGTAAGATGGGAAGATGG - Intronic
944183928 2:196926928-196926950 TGAGGGGAAAGAAGGGAAGTGGG + Intronic
944318447 2:198308281-198308303 TGTGGGGGAACATGGGAAGAAGG - Intronic
944606847 2:201359456-201359478 TATTGTGTAAGGAGAGAAGAGGG + Intergenic
945008968 2:205441511-205441533 TGGTGGGGAAGAAGGGTAGCAGG + Intronic
945489356 2:210436459-210436481 TGATAGATAAGAAGGAAAGAGGG + Intronic
946659241 2:221981762-221981784 TTTTGGGGAAGAATGGGAGAAGG - Intergenic
946775927 2:223140957-223140979 TCTTGGGAAAGAGGGGAAGAAGG + Intronic
946885401 2:224217504-224217526 TATTGGGTAAAAAGGGAAACAGG - Intergenic
947020163 2:225665906-225665928 AGTGGGATAAGAAGGAAAGAAGG - Intergenic
947332448 2:229044414-229044436 TGTCGGGGAAGCAGGGGAGAGGG - Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948474524 2:238208427-238208449 TGATGGGTTAGAAAAGAAGAGGG + Intergenic
948614558 2:239190218-239190240 TGTTGGGCAAGAGGGGGACAGGG - Intronic
1170506878 20:17035589-17035611 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1172663890 20:36586006-36586028 TGTTGGGTGAGAAAGGAACCTGG + Intronic
1172712306 20:36935012-36935034 TCTAGGGTAAGAAGGGAATGGGG - Exonic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172927957 20:38557514-38557536 TGTTGAGTGAGGAGTGAAGAGGG - Intronic
1173362637 20:42358472-42358494 TGTTCTGAAGGAAGGGAAGATGG + Intronic
1173522888 20:43712306-43712328 TGTTAGGTAAGGAGGGGAGGTGG + Intronic
1174411692 20:50340669-50340691 TTTGTGGTGAGAAGGGAAGAAGG + Intergenic
1174685027 20:52446432-52446454 TGTTGGGGAAGAGTGGAAGCAGG + Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175927754 20:62479371-62479393 AGTTTGGCAAGAAGAGAAGAGGG - Intergenic
1176942491 21:14940794-14940816 AGTTGGTTGAGAAGAGAAGAGGG - Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1177953480 21:27568173-27568195 TGTTGCCTAAGAAAGGAACATGG + Intergenic
1178085165 21:29105026-29105048 TGTTTCCTAAAAAGGGAAGAAGG + Intronic
1178153131 21:29819226-29819248 TGTTTGGTGAGATGGGAAGAAGG - Intronic
1178524188 21:33311777-33311799 TGTAGGATAAGTAGGGAAGTAGG - Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1180214488 21:46315722-46315744 TGTTGGGTAAGGAGGGCAAGGGG + Intronic
1181454024 22:23044930-23044952 AGTAGGGAAAGCAGGGAAGAAGG + Intergenic
1182680547 22:32076041-32076063 TGATGGGTGAGAAGAGAGGAGGG + Intronic
1182755150 22:32673270-32673292 TGTTGTGTCAGAAATGAAGAGGG + Intronic
1182797024 22:32998388-32998410 TGTTGGGTAAGAAATTAAAAGGG - Intronic
1183067069 22:35370584-35370606 TGTTGGGTAATGGGGGAAAATGG + Intergenic
1183337650 22:37259813-37259835 GGTTGGGTAGGAAGGGGAGGGGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
949359997 3:3221570-3221592 TGATGGGGATGAAGGGGAGAAGG - Intergenic
949839419 3:8304057-8304079 TGTTGGGTTAAAGGGGAAGGAGG - Intergenic
949920507 3:8996546-8996568 TGTTGGGAGAGAAGGAAGGAGGG + Intronic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950941399 3:16896788-16896810 TTTTGGGTAGGAAAGGACGAAGG + Intronic
951195960 3:19823535-19823557 TGTAGGGTAAGAAGGATAGTAGG - Intergenic
951739044 3:25899552-25899574 TGTGTGGTCAGAAGGGAAGTTGG - Intergenic
952144860 3:30521087-30521109 TGAAGGGAAAGAAGGGAAAAGGG - Intergenic
952530665 3:34258885-34258907 TGTGGGATAAGTTGGGAAGAAGG + Intergenic
952540378 3:34361063-34361085 TGTTGGGTATGTTGGGCAGATGG + Intergenic
952978107 3:38713494-38713516 TTATGGGTGACAAGGGAAGATGG + Intronic
953298025 3:41741074-41741096 AGTTGGTTAAGAAGGGATTAAGG - Intronic
953342808 3:42149816-42149838 TGTTTGCTTAGAAGGGGAGATGG + Intronic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
953598247 3:44338132-44338154 TCTTGGGGAAGAAGGGGAAAGGG - Intronic
954361822 3:50126229-50126251 TGTGGGGTCAGAAGGGATGGTGG + Intergenic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954648127 3:52143800-52143822 TTTAAGGTATGAAGGGAAGAAGG - Intronic
954880102 3:53829634-53829656 TGTGGGGCAAGAGGGGAAGAGGG - Intronic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
956534228 3:70257487-70257509 GGAAGGGAAAGAAGGGAAGAAGG + Intergenic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
956769860 3:72516146-72516168 CGTGGGGAAAGAAGGGAGGAGGG - Intergenic
957209906 3:77246367-77246389 TGTTGGCTAAGTATGGAGGAAGG + Intronic
957962555 3:87276684-87276706 TTTGGGGTAAAAAAGGAAGACGG - Intergenic
959401977 3:105913879-105913901 TATTGGGCAAAAAGGAAAGAAGG - Intergenic
960951521 3:123001476-123001498 TATTGAGTATGAAGGGAAAAAGG - Intronic
961831517 3:129625391-129625413 TGTTTGGGAAGAAGGCTAGATGG + Intergenic
962564649 3:136645341-136645363 AGTTGGGGAAGAAAGGAAGCAGG - Intronic
962949308 3:140203421-140203443 TGTTGGCTGATGAGGGAAGAGGG + Intronic
963698687 3:148596784-148596806 TGGAGGGTGAGAAGAGAAGAAGG - Intergenic
964707037 3:159629998-159630020 TGAGGGGTAAGAAGGAAATAAGG + Intronic
965423838 3:168497351-168497373 TGTGGGGACAGACGGGAAGAGGG - Intergenic
965481454 3:169224216-169224238 TGTTGGTGATGAAGGGCAGATGG - Intronic
965679171 3:171232744-171232766 TGAGGGAGAAGAAGGGAAGAGGG - Intronic
966173420 3:177109497-177109519 GGTGGGGAAAGAAAGGAAGAAGG + Intronic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
967863534 3:194171747-194171769 TGTTGGGTAGGAAGGGGAAAAGG + Intergenic
969237298 4:5874600-5874622 TGCTGGGCAGGAGGGGAAGAGGG + Intronic
972420427 4:38881483-38881505 TGTTGGGTCAGAAGCTCAGAGGG + Intronic
973096775 4:46212253-46212275 AGGAGGCTAAGAAGGGAAGATGG + Intergenic
976595317 4:86890160-86890182 TGTCAGGAAAGAAGGAAAGAAGG + Intronic
977178438 4:93842836-93842858 TGTTTGGTGAGGAGGTAAGAAGG + Intergenic
977376508 4:96211979-96212001 TGTGGAGTAGGAAGAGAAGAGGG + Intergenic
977443734 4:97101982-97102004 TGGTGAGTAAGAAGGGGAGCAGG - Intergenic
978832880 4:113110483-113110505 TGTTGGTAAAGAAGTGAAAATGG + Intronic
979189143 4:117834927-117834949 TGTTGGGGTGGAAGTGAAGATGG + Intergenic
979546066 4:121941431-121941453 TGAAGGGCAAGAAGGGCAGATGG + Intronic
980502066 4:133668894-133668916 TGATAGGTAAAAAGGAAAGAGGG - Intergenic
980741714 4:136958405-136958427 TGATGGGAAAGCAGGGAATAAGG - Intergenic
980980574 4:139651372-139651394 TGTTGGGTAAGCAGGCAGGAAGG + Intergenic
981919012 4:150066702-150066724 TGGTGGGTCAGAAGTGTAGATGG + Intergenic
982019325 4:151188004-151188026 TGTTGGGTAGGAGGGGAGAAAGG - Intronic
982274818 4:153628116-153628138 AGTTGGGGAGGAAGGGAAGCAGG - Intronic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984095711 4:175430018-175430040 TATAAGGGAAGAAGGGAAGATGG + Intergenic
986063690 5:4215531-4215553 TGATGGGTAAAAAGTGAAGTGGG - Intergenic
986327400 5:6686460-6686482 TGTTGGGGATAATGGGAAGAGGG - Intergenic
986994099 5:13586625-13586647 TGTGGGGCAAGAGGGGAAGAGGG - Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
988148497 5:27344101-27344123 TATTGGGGAAAATGGGAAGAAGG + Intergenic
988217174 5:28289900-28289922 TGATGGCTAAGCAAGGAAGAGGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988687093 5:33535794-33535816 CGTTGGGTAAAAAGAGAAGTGGG + Intronic
989285126 5:39690637-39690659 AGTTGGGTGAGAAGGTAAAAAGG + Intergenic
989438167 5:41438609-41438631 TATTGGGTGAAAAGGGAAAAAGG - Intronic
990110453 5:52316576-52316598 TGTGGGGTTGGAGGGGAAGAGGG + Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
992527919 5:77630007-77630029 AGCTGGGTGGGAAGGGAAGAGGG + Exonic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993041117 5:82815961-82815983 TGTTGGGTAACCAGAGAGGAAGG - Intergenic
993674636 5:90802219-90802241 TTTTGGGGGAGAAGGGGAGACGG + Intronic
993875671 5:93303875-93303897 ACTTAGGTAAGAAGTGAAGATGG - Intergenic
994302425 5:98161182-98161204 TGAGGGGTATGAAGGGATGAAGG - Intergenic
994826264 5:104716820-104716842 TGGTAGATAAGAAAGGAAGAGGG - Intergenic
995321035 5:110834311-110834333 TGTAGAGAAAGAAGAGAAGAGGG - Intergenic
996477590 5:123938494-123938516 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
996818046 5:127595307-127595329 TGCCAGGTAAGATGGGAAGAAGG - Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997726829 5:136128016-136128038 AGTGGAGTAAGAAGAGAAGAGGG + Intergenic
997873884 5:137531050-137531072 TGTTGGGGAAGGAGGTAATATGG + Intronic
999550622 5:152683360-152683382 TGGTGTGGAAGAAGGGAACAGGG + Intergenic
1000019077 5:157303428-157303450 TGTTGGGCAAAATGGGAAAATGG - Intronic
1000241831 5:159415873-159415895 TGTTGGGCAAAAAGGAAAAAAGG - Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000707073 5:164525555-164525577 AGTAGGCTAAGATGGGAAGACGG - Intergenic
1000910761 5:167019337-167019359 TGCTGAGTAAGAAGGCAAAATGG + Intergenic
1001678406 5:173537454-173537476 TGCTGGGGAAGAGGGGAATAGGG - Intergenic
1001877431 5:175213502-175213524 TGATGGTGAAGAAGGAAAGAAGG - Intergenic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1005578000 6:27208124-27208146 TATTGGGTGAAAAGGGAAAAAGG + Intergenic
1006783680 6:36650334-36650356 TGTAGGGGAAGAAGGGAAAGGGG - Intergenic
1007357247 6:41330236-41330258 TGTTGGGGAAGAAGTGGTGAAGG - Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008245207 6:49162828-49162850 TGTTGAGTAACAGGGGAGGAAGG + Intergenic
1008372930 6:50756325-50756347 GGCTGGGAAAGAAGTGAAGAGGG + Intronic
1008504362 6:52215115-52215137 TGTGGGGTAAGGTGGGAATAAGG + Intergenic
1008699650 6:54083398-54083420 TGTTGGGGAAGCAGGGAGGAAGG + Intronic
1009202898 6:60767523-60767545 TCTTCGGAGAGAAGGGAAGAAGG - Intergenic
1010772143 6:79844388-79844410 TTTGAGTTAAGAAGGGAAGAGGG - Intergenic
1012400817 6:98842069-98842091 TGTTGTTTAAAAAGGAAAGAAGG + Intergenic
1012941891 6:105424270-105424292 TGTTAGTGAAGAAGGGATGAAGG - Intergenic
1013952836 6:115805650-115805672 TGTTGGGTGGGAATGGAGGAGGG + Intergenic
1014400245 6:120979846-120979868 TATTGGAAAAGAAGGGAATATGG + Intergenic
1014509415 6:122302670-122302692 TGGTGGGTAAGAAGGAGGGAGGG - Intergenic
1014950226 6:127545652-127545674 TGATGGGTGAGAAGGGGAAAGGG - Intronic
1015231767 6:130923053-130923075 TGTTCAGTAAGAAGGGTAGGAGG - Intronic
1015550095 6:134402946-134402968 TCCTGGGAAAGAAGGGAGGAAGG - Intergenic
1015614693 6:135062801-135062823 GGCTGGCCAAGAAGGGAAGATGG - Intronic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1016014617 6:139171083-139171105 TGTTGGGTTTGAAGGGATGTTGG + Intronic
1016100826 6:140098015-140098037 TGTTGGGGAAGGAGGGAGCAAGG - Intergenic
1016646190 6:146411267-146411289 AGTTGGTTAGGAAAGGAAGAAGG + Intronic
1016774561 6:147891179-147891201 TCTTGGGGAGGAAGGGAAAAGGG + Intergenic
1017071887 6:150582580-150582602 TGGTGGGTAAGAAGAGAACAGGG - Intergenic
1018037554 6:159894181-159894203 TGTGGAGTAGGAAGGGAAGAGGG + Intergenic
1018082643 6:160271535-160271557 GGTTTGGGAAAAAGGGAAGAAGG - Intronic
1018345539 6:162895163-162895185 TGGAGGCTGAGAAGGGAAGATGG + Intronic
1018545994 6:164936359-164936381 TGTTGGGATGGAAGGGAACATGG + Intergenic
1020541759 7:9467734-9467756 GGCTGGCAAAGAAGGGAAGATGG + Intergenic
1021327584 7:19293466-19293488 AGTTGGGTAAAGATGGAAGAAGG + Intergenic
1021329929 7:19323977-19323999 AGTCAGGTAAGAAGGGAGGAAGG + Intergenic
1021439768 7:20664708-20664730 TGGTGGGTAAGAAGAGTAAATGG - Intronic
1021591789 7:22271699-22271721 TGTTGGGTAACTAGGGGAGAGGG - Intronic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022320090 7:29279913-29279935 TGGTGGGTAAGAAAAGAAGCAGG + Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022572066 7:31464513-31464535 TCTTGGGAAAGAAAGGAACATGG + Intergenic
1022993886 7:35733974-35733996 GGATGGGTAAGAAGGGGGGAAGG + Intergenic
1023689693 7:42773068-42773090 TGGTTGGTAAGAAAGGAAGAAGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1024974947 7:55104696-55104718 GGTTGGGAGAGAGGGGAAGAGGG - Intronic
1025021293 7:55482319-55482341 TTTTGGGGAAGAGAGGAAGAAGG + Intronic
1026327105 7:69320074-69320096 TGCTGGGGAAGAAGGAAAAACGG + Intergenic
1026410175 7:70112799-70112821 TGTTGGGTAAGACAGAGAGATGG - Intronic
1026625889 7:71991807-71991829 TGTTTTTTAAGAAAGGAAGAGGG - Intronic
1026860063 7:73780447-73780469 GGTTGAGTTAGAAGGGAAGTAGG - Intergenic
1027813654 7:82940539-82940561 TGATTGGAAAGAAAGGAAGAGGG + Intronic
1030924997 7:115440979-115441001 TTTTGGTTAAGAAAGTAAGAAGG + Intergenic
1030948481 7:115758789-115758811 TGTTGTTAAAGAAGGGAAGAAGG - Intergenic
1030988777 7:116274206-116274228 GGTTGGTGAAGAAGGGAAGTGGG + Intergenic
1031417954 7:121515881-121515903 TGGTGAGTCAGAATGGAAGACGG - Intergenic
1032300172 7:130679452-130679474 TGTGGGGTAAGAACAGAAGCTGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1032792084 7:135249880-135249902 TGTTGGGTATTAAGGGAAGCTGG + Intronic
1033683897 7:143621584-143621606 TGGCGGATAGGAAGGGAAGAGGG + Intronic
1033700715 7:143836054-143836076 TGGCGGATAGGAAGGGAAGAGGG - Intergenic
1033813406 7:145044522-145044544 TGTTGGGAAAAATGGGCAGAAGG + Intergenic
1034076359 7:148235518-148235540 GGTTGGGGAAGCAGGGAAGTTGG - Intronic
1034844514 7:154431836-154431858 AGTCGGGTAAGAAAGGGAGAAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035486409 7:159229660-159229682 TGTTAAGGAAGAAGTGAAGAGGG + Intergenic
1036682440 8:10885439-10885461 AGTAGGGAAAGAAGGCAAGAAGG - Intergenic
1037107202 8:15123860-15123882 TTTCAGGTAAGAATGGAAGAAGG + Intronic
1037415490 8:18645121-18645143 TGTTAGGTCATAAGGGAAAAGGG - Intronic
1037638309 8:20720217-20720239 TCTTGGAAAAGAAGGGCAGAGGG - Intergenic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1038962826 8:32540225-32540247 TCTTAGGGAAGAGGGGAAGAAGG + Intronic
1039252771 8:35684768-35684790 TGGTGGATCAGAAGGGAAAAGGG - Intronic
1039404050 8:37297665-37297687 TGCTGGGAAAGAAGTGAAGTGGG - Intergenic
1040746133 8:50644380-50644402 TGTTGAGTAGGCTGGGAAGAAGG - Intronic
1040892976 8:52336654-52336676 GGTTGGGTGAGATGGGAAGCGGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043012764 8:74901049-74901071 TGTTGGGTAATCTGGGCAGATGG + Intergenic
1044220245 8:89662245-89662267 TCAAGGATAAGAAGGGAAGAAGG - Intergenic
1044404287 8:91809962-91809984 TGTTGGAGAAGATAGGAAGAAGG + Intergenic
1044854582 8:96461965-96461987 AGTGGGATAAGAAAGGAAGAAGG - Intergenic
1045502050 8:102751161-102751183 TATTATGGAAGAAGGGAAGAAGG - Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047534621 8:125708346-125708368 TGTAGGGCAAGAACGGAATAAGG + Intergenic
1047632722 8:126725817-126725839 TGGTGGGTAACATGGGAAAATGG + Intergenic
1048088202 8:131207966-131207988 TGTGGTGTAAGAAGGGAATGAGG - Intergenic
1049264373 8:141659595-141659617 TGCTGGGTGACAAGGAAAGATGG - Intergenic
1050496967 9:6253226-6253248 TGTTGTGAAAGATGGAAAGAGGG + Intronic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1052065821 9:24018234-24018256 TTTTGTGTAAGATGGAAAGAAGG + Intergenic
1052475700 9:28956638-28956660 GGGAGGGAAAGAAGGGAAGAAGG - Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1052885174 9:33639465-33639487 TGTTGGGTGAGCAGGGCTGAGGG - Intergenic
1054958968 9:70945846-70945868 TGTGGGGAGAGAAGGGGAGAAGG + Intronic
1055747515 9:79466416-79466438 TTTTGGGTTAGAAGAAAAGAAGG - Intergenic
1055753245 9:79530157-79530179 GGAAGGGTAAGAAGGAAAGAAGG - Intergenic
1056138887 9:83655356-83655378 GGTTGGGTGAGGAGGGAATAGGG + Intergenic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056317755 9:85407877-85407899 TGTTGAGAAAGAGAGGAAGATGG + Intergenic
1056780847 9:89549284-89549306 GGTAGGGTAATAAGGGAAGTGGG - Intergenic
1056859793 9:90170449-90170471 TGTTGGAGCAGAATGGAAGAAGG + Intergenic
1056964556 9:91155032-91155054 TGTTTGGGGAGAAGGGAAGGTGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057905131 9:98977311-98977333 TGCTGGGCAAGAAGGGAGGAGGG - Intronic
1058129968 9:101240664-101240686 TGTGGGCTAAGAAGGGAGGTTGG - Intronic
1058958330 9:109969740-109969762 TGTGGTGTAAGCAGGGAAGCTGG - Intronic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059893862 9:118837160-118837182 TGTTGGGCAAGAAAAGAAGTGGG + Intergenic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060789844 9:126478586-126478608 GGATGGGTAAGCCGGGAAGAGGG + Intronic
1062114888 9:134802974-134802996 TGCTGGAAAAGAAGGGACGAAGG + Exonic
1185876172 X:3704065-3704087 TGTTGGGTGAGACAGGATGATGG - Intronic
1186240185 X:7557216-7557238 TGTTGGCAAAGATGGGAAGGTGG - Intergenic
1186335251 X:8579910-8579932 TGGTAGGTAGGAAGGGAAGTAGG - Intronic
1186423125 X:9442773-9442795 TCTTGTCTAAGAAGGGGAGAAGG - Intergenic
1186495902 X:10013093-10013115 TGTTGGGTGGTAAGGTAAGAAGG + Intergenic
1186716761 X:12260127-12260149 TGTTGACTAAGAAGGAAAAAAGG - Intronic
1187400585 X:18956369-18956391 TGTTGGGTAAGCCGGGGACAGGG + Intronic
1187722104 X:22161894-22161916 TGATGGATGAGAAGGGAAGGGGG + Intronic
1187785981 X:22887183-22887205 TGATGGGTCAGAAGTGCAGATGG - Intergenic
1188752677 X:33923261-33923283 TGCTGGCTAAAAAGGCAAGAGGG + Intergenic
1189042084 X:37553559-37553581 TATTGGGTGAAAAGGGAAAAAGG + Intronic
1189357529 X:40322610-40322632 GGTAGGGTAGGAAGGAAAGATGG - Intergenic
1189420681 X:40855077-40855099 TATTAGACAAGAAGGGAAGAAGG + Intergenic
1190659701 X:52643085-52643107 TGTGGGGAAGGAAGGGCAGAGGG - Intergenic
1190663826 X:52679338-52679360 TGTGGGGAAGGAAGGGCAGAGGG + Intronic
1190675597 X:52779084-52779106 TGTGGGGAAGGAAGGGCAGAGGG - Intronic
1191597367 X:62960246-62960268 GGTTGGCAGAGAAGGGAAGATGG - Intergenic
1192494472 X:71605915-71605937 AGTGGGGAAAGAAGGGAGGAAGG - Intronic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193711208 X:84882617-84882639 TGTTGGGTAAACATGAAAGATGG - Intergenic
1194945694 X:100064254-100064276 TGTAGGATGAGAAGGGAAGGAGG + Intergenic
1195589977 X:106612729-106612751 TGTTTGGAAAGAACGGCAGAGGG + Intronic
1196038288 X:111171699-111171721 TTTTGGGAACTAAGGGAAGATGG + Intronic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1197026093 X:121751454-121751476 TGATGAGTAAGAGGGAAAGAGGG + Intergenic
1197154625 X:123256996-123257018 GATTGGGTAAGATGGTAAGATGG + Intronic
1197655707 X:129114019-129114041 AGTTGGTTCAGAAGGGAACAGGG - Intergenic
1198983518 X:142425488-142425510 TGTTGGATAAGAAGGCTACAGGG + Intergenic
1199298491 X:146186125-146186147 TGATGGACAAGAAGGGAAAAAGG + Intergenic
1199661673 X:150056971-150056993 TGATTGCTAAAAAGGGAAGAAGG - Intergenic
1199764591 X:150931826-150931848 AGTGGGGCAAGAAGGAAAGACGG - Intergenic
1200384805 X:155880039-155880061 TGAAGAGTAAGAAGAGAAGATGG + Intergenic
1200789411 Y:7286357-7286379 TGTTGGGTAACACAGGATGATGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic