ID: 1157643106

View in Genome Browser
Species Human (GRCh38)
Location 18:49238038-49238060
Sequence CATTTTGCACAAATGCACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157643103_1157643106 29 Left 1157643103 18:49237986-49238008 CCTAATCTTTTGCTATTATAAAA 0: 2
1: 1
2: 18
3: 99
4: 807
Right 1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 141
1157643105_1157643106 -1 Left 1157643105 18:49238016-49238038 CCAAAATAAACTAGTACATTGTC 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 141
1157643104_1157643106 0 Left 1157643104 18:49238015-49238037 CCCAAAATAAACTAGTACATTGT 0: 1
1: 0
2: 1
3: 15
4: 324
Right 1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157643106 Original CRISPR CATTTTGCACAAATGCACGT AGG Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
901263080 1:7887969-7887991 CATCTTTCACAAATGCACTTTGG - Intergenic
902033033 1:13436568-13436590 CATTTTGCAGAAGGGCATGTGGG + Intergenic
904584004 1:31569111-31569133 ACTTTGACACAAATGCACGTGGG - Intergenic
905674816 1:39817980-39818002 CATGTGGCACAAATGCTCATGGG - Intergenic
908079053 1:60555277-60555299 CATTTTACACAAATGTTCATAGG + Intergenic
909181519 1:72429794-72429816 TATTTTGCAGAAATGGATGTTGG - Intergenic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
919551706 1:198998001-198998023 CATTTTGCACTACTGAAGGTTGG + Intergenic
920711074 1:208295571-208295593 CATTTTCCACAAATCCATCTTGG + Intergenic
920988252 1:210910999-210911021 CAATCTACACAAATGCAAGTAGG - Intronic
921423793 1:214979061-214979083 CATATAGCACACATGCACGTCGG + Intergenic
923897192 1:238284759-238284781 CATTTTTCTGAAATGCACGGTGG + Intergenic
924721753 1:246629577-246629599 AATTTTGCACAAATGCAAAAAGG + Intronic
1063902721 10:10751257-10751279 CATTTGGCATAAATGCTTGTAGG - Intergenic
1068206003 10:53854292-53854314 CATTTTGCACAACTGAAATTTGG - Intronic
1071139034 10:82485528-82485550 CATTTTTTACAAATGCTAGTTGG - Intronic
1071792350 10:88968523-88968545 CATTTTGCACACATGTTTGTCGG + Intronic
1076264076 10:129095254-129095276 CATTTCACACAAATGCACTCCGG + Intergenic
1077270477 11:1676452-1676474 AATTTTGCACAAATGCCTGCTGG + Intergenic
1082287586 11:50334180-50334202 CCTTTTGCACTAAAGCGCGTTGG + Intergenic
1087467277 11:98525203-98525225 CAGTTGGCACCAATGCACTTTGG + Intergenic
1092769087 12:11880707-11880729 CATTTTGCCCATATGAAGGTGGG - Intronic
1093464751 12:19438517-19438539 CATCTTGCAGAAATGAACTTGGG - Intronic
1093987181 12:25548571-25548593 CATTTTCCACAAATGCAAATGGG - Intronic
1094217195 12:27955660-27955682 CAATTTACACAAAGGCAAGTTGG - Intergenic
1095501213 12:42840576-42840598 CATTTTGCACAACTGAAACTTGG + Intergenic
1096935667 12:55271467-55271489 CATTCTACACAACTGCAAGTTGG + Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1097100069 12:56581457-56581479 CATTTTGCACAAATTTTCCTTGG - Exonic
1100381564 12:94066530-94066552 CATGTTGCAAAGATGCACATAGG + Intergenic
1100420094 12:94424266-94424288 CATTTTGCACAAATATTCCTTGG + Intronic
1100484569 12:95012652-95012674 CTTTTTTCAAAAATGCATGTAGG + Intergenic
1102486049 12:113258075-113258097 GATTTTACAGATATGCACGTAGG + Intronic
1104593277 12:130101663-130101685 CGTTTTACAAAAATACACGTGGG + Intergenic
1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG + Intergenic
1107539212 13:41370450-41370472 CATTTTGTGCAAATGCAGTTGGG + Intronic
1108488596 13:50954935-50954957 CAATTTGCAAAAATGCAAATGGG - Intronic
1109005929 13:56876103-56876125 CATTTTGAACAACTGCACTAAGG + Intergenic
1110563200 13:76931251-76931273 CATTTTATACAAATGCAGTTAGG - Intergenic
1111252174 13:85615811-85615833 AATTTGGCACAAATGCACCATGG - Intergenic
1114174191 14:20304646-20304668 CATTTACCACAAATGAACCTAGG + Intronic
1115855230 14:37623028-37623050 CATTTTTCCCAAATGCAATTTGG + Intronic
1117336309 14:54759850-54759872 CATTTTACAGAAATGCACAGAGG + Intronic
1118313575 14:64710088-64710110 CATTTTGCTCCCATGCAAGTTGG + Intronic
1118855521 14:69618989-69619011 CATTTTAAAGAAATGCAAGTGGG + Intronic
1121536191 14:94692421-94692443 CCTGGTTCACAAATGCACGTGGG + Intergenic
1123668721 15:22631129-22631151 CATTTTTCAAAATTGCATGTTGG + Intergenic
1124524697 15:30437606-30437628 CATTTTTCAAAATTGCATGTTGG + Intergenic
1124773956 15:32570106-32570128 CATTTTTCAAAATTGCATGTTGG - Intergenic
1125098528 15:35882639-35882661 CATCTAGCACAAATGTATGTGGG - Intergenic
1127080177 15:55370220-55370242 CCTTTTCCACAAATCCACATAGG + Intronic
1134823078 16:17262343-17262365 TAATTTGCACAAATTCATGTTGG + Intronic
1135123282 16:19785148-19785170 TAATTTGCTCAAATGCACCTTGG - Intronic
1135734713 16:24921442-24921464 CATTTTGCACCACAGCAAGTAGG - Intronic
1138871920 16:60900648-60900670 CATTTTTCACAAATGTTCCTGGG + Intergenic
1139203499 16:65003608-65003630 CATTTTACTCAAATGCTAGTGGG + Intronic
1144640344 17:16933377-16933399 CATTTTCCACAACTGCCCGAGGG + Intronic
1145189338 17:20824961-20824983 CATTTTCAACAACTGCACTTTGG - Intergenic
1151514123 17:74581139-74581161 CAGTTTGCACAAAAGCATGGAGG + Intronic
1153756583 18:8289766-8289788 AATTCTGCACAATTTCACGTTGG + Intronic
1154316268 18:13306213-13306235 CATTTTGTGCAAATGCAGTTGGG + Intronic
1154496656 18:14966214-14966236 CAATTTGCCCAAATTCACATGGG + Intergenic
1155699996 18:28731864-28731886 CATTTTCCTCAAATGCACCCGGG - Intergenic
1156426674 18:37020799-37020821 CTGTTTGCACATACGCACGTAGG + Intronic
1156429541 18:37057058-37057080 CATTTAGCAGAAAAGCATGTAGG - Intronic
1157618658 18:49002807-49002829 CATTCTTCACAAAGGCATGTGGG - Intergenic
1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG + Intronic
1164184907 19:22856933-22856955 CATTTTCCACAAATGTATTTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
928274240 2:29884971-29884993 CATTTTGTGCAAATGCAGATGGG + Intronic
932694700 2:73945696-73945718 AATTTTGTACAAAAGCACTTTGG - Intronic
935723758 2:106003812-106003834 CATTCTTCTCAAATGCACATGGG - Intergenic
935814320 2:106832349-106832371 GATTCTGCACAAAAGCACTTTGG + Intronic
936120358 2:109737280-109737302 CCTTTTGGAAAAATGCACCTTGG + Intergenic
936224336 2:110634166-110634188 CCTTTTGGAAAAATGCACCTTGG - Intergenic
936583224 2:113725618-113725640 GATTTTGCACAAAAGCACTCTGG + Intronic
936773460 2:115943047-115943069 CAATTTGCTCTAATGCACGAGGG - Intergenic
942308593 2:174632996-174633018 CCCTTTGCACAAATGCCTGTAGG - Intronic
946255681 2:218440224-218440246 CATTTTCCACCAATGGACTTCGG + Intronic
948703565 2:239775897-239775919 AATTTTTCAGAAATGCACGGGGG + Intronic
1170810519 20:19670413-19670435 CATTTTGCAGAGATGCCTGTAGG - Intronic
1173020762 20:39266019-39266041 CAGTGTGTACATATGCACGTGGG - Intergenic
950377128 3:12581050-12581072 CATTTTGCTCAAATGAACTCTGG - Intronic
951449531 3:22820705-22820727 CATTTTTCACAAAAACATGTTGG - Intergenic
956910241 3:73809037-73809059 CTTTTTGCTCTAAAGCACGTTGG - Intergenic
957518476 3:81287639-81287661 CATTTTGTACAAATAAAAGTGGG - Intergenic
964604059 3:158540117-158540139 TATTCTGCACAAGTGCAAGTGGG - Intronic
965116594 3:164497612-164497634 AATTTTGCACAAATGTTCTTTGG - Intergenic
965853767 3:173063736-173063758 CATTTTGCTTAAATGTAAGTGGG + Intronic
967103947 3:186240368-186240390 CATTTTGGACAGACGCATGTAGG - Intronic
967894197 3:194383657-194383679 CATTTTGCAGAAATGCACCTTGG - Intergenic
969113109 4:4855801-4855823 CATTTTTAAAAAATGCACGCGGG + Intergenic
971101917 4:23476272-23476294 CAATTTGTACAAAAGCAAGTTGG - Intergenic
975719409 4:77235415-77235437 CATTTTGCAGCACTGCACTTGGG - Intronic
980015618 4:127646702-127646724 CAGTTTTCACAAAAGCAAGTTGG + Intronic
981545186 4:145886188-145886210 CATTTTCCATAAATGCACGGTGG - Intronic
984318133 4:178156043-178156065 TCTTTTGCACCAATGCAAGTTGG - Intergenic
987967855 5:24899127-24899149 CATTTTGTACATAGGCAAGTGGG + Intergenic
990292863 5:54371969-54371991 CATTTTTCTCAAGTGCACATGGG - Intergenic
990854590 5:60249686-60249708 CATTTTGCAAAGATACAGGTAGG + Intronic
993155043 5:84211916-84211938 CAATTTGCACAAATCCAAGAGGG + Intronic
993454781 5:88115358-88115380 CATTTGGCAGAAATGCAAGGTGG + Intergenic
994333521 5:98536755-98536777 CATTTTTAAAAATTGCACGTGGG + Intergenic
994717452 5:103338803-103338825 CATTCTGCAGAAAGGCAAGTGGG - Intergenic
994865035 5:105257569-105257591 CATTTTGCACCAGTGTAGGTAGG - Intergenic
995664328 5:114524175-114524197 CATGTTGCAAAAATCCATGTAGG - Intergenic
995773082 5:115693328-115693350 CATTTTTCTCAATTGCACATGGG - Intergenic
997142459 5:131397310-131397332 CATTTTTCACAAGTGTATGTAGG + Intronic
999515209 5:152295111-152295133 CATTTTGCTTAAATCCACATAGG + Intergenic
1000850542 5:166334692-166334714 TATTTTGCACACATGCCCATAGG - Intergenic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1005529470 6:26688382-26688404 AATTCTGCACACATGCATGTAGG - Intergenic
1005541326 6:26813264-26813286 AATTCTGCACACATGCATGTAGG + Intergenic
1005551074 6:26916081-26916103 CATTTTTCACTAATGCGCATAGG + Intergenic
1005949097 6:30617960-30617982 CATTTTGCACAACCTCAAGTTGG + Intronic
1007086910 6:39154703-39154725 CATTGAGAACAAATGCATGTAGG - Intergenic
1008690063 6:53968302-53968324 CCATTTGCAGAAATGCACCTGGG + Intronic
1009012129 6:57855328-57855350 AATTATGCACACATGCATGTAGG + Intergenic
1009293176 6:61909757-61909779 CATTTTGCCCAAATACAAATTGG + Intronic
1018543462 6:164909868-164909890 CACTTTCCACAAATGGATGTTGG - Intergenic
1021336063 7:19404198-19404220 CATTTTGTAAGAATGAACGTAGG - Intergenic
1029988779 7:104944361-104944383 TATTTTGCAGGAATGCAGGTGGG + Intergenic
1031188014 7:118507647-118507669 CATTTTGCACAGATTCCTGTGGG + Intergenic
1034831907 7:154315977-154315999 CATTTAGCACACAAGCAAGTGGG - Intronic
1038865655 8:31436354-31436376 CATTTTGCAGAAGTACACATGGG - Intergenic
1038989425 8:32850851-32850873 CATTTTTCTCAAGTGCACATAGG - Intergenic
1044594287 8:93942952-93942974 TATTTTGCACAGAGGCACGGAGG - Intergenic
1044638215 8:94349933-94349955 CATTCTTCTCAAGTGCACGTAGG + Intergenic
1045831934 8:106472226-106472248 CTTTTTGCACAAATGCATCCTGG - Intronic
1046579497 8:116074290-116074312 CATTTTTAACAAATGCATGCTGG - Intergenic
1050150097 9:2611010-2611032 CACTTTGCACAAATTCACTGAGG + Intergenic
1050505821 9:6348171-6348193 CATTCTTCCCAAATGCACATGGG + Intergenic
1050924935 9:11252297-11252319 CATTTTTCTCAAATGCACATGGG + Intergenic
1055023985 9:71699710-71699732 CAGTGTGCACAAATGCATGGGGG - Intronic
1056023861 9:82470756-82470778 CATTCTTCTCAAGTGCACGTGGG + Intergenic
1058782617 9:108353381-108353403 CTTTTTGCACAAATACATTTTGG + Intergenic
1059344762 9:113620658-113620680 CACTTTGCAAAAATGCAGGCGGG - Intergenic
1059644480 9:116251244-116251266 CATTTTCCCCAAGTGCACATGGG + Intronic
1060611052 9:124964902-124964924 TATTTTGTGCAAATGCACTTGGG - Intronic
1195309645 X:103618989-103619011 CATTCTTCTCAAATGCACATGGG + Intronic
1195527745 X:105911373-105911395 CCTTTTACACAAATGGATGTGGG - Intronic
1196079923 X:111620194-111620216 CATCTGGCAGAAATGCACGAAGG - Intergenic
1197068169 X:122259378-122259400 CATTTTACTAAAATGCACGTAGG - Intergenic
1197168915 X:123409733-123409755 CATTTTTTACAAATGCATATGGG + Intronic
1197276505 X:124485626-124485648 CTATTTGCACAAAAGCACTTTGG + Intronic
1197713241 X:129687231-129687253 CATTTTGATCAAATGTAGGTGGG - Intergenic
1198189875 X:134292016-134292038 CATTCTTCAAAAGTGCACGTGGG - Intergenic
1198830109 X:140741439-140741461 CAAATTGCAGAAATGCACATAGG + Intergenic
1199819626 X:151431951-151431973 CATTTTGCACAAATTCAGGCAGG - Intergenic